Incidental Mutation 'R6129:Hps5'
ID487572
Institutional Source Beutler Lab
Gene Symbol Hps5
Ensembl Gene ENSMUSG00000014418
Gene NameHPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonymsru-2, ru2, ruby eye 2
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46760466-46796064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46771774 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 755 (V755A)
Ref Sequence ENSEMBL: ENSMUSP00000103281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014562] [ENSMUST00000107653] [ENSMUST00000107654] [ENSMUST00000142663] [ENSMUST00000211347]
Predicted Effect probably benign
Transcript: ENSMUST00000014562
AA Change: V755A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014562
Gene: ENSMUSG00000014418
AA Change: V755A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107653
AA Change: V722A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418
AA Change: V722A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 6e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 396 416 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 956 965 N/A INTRINSIC
low complexity region 988 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107654
AA Change: V755A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418
AA Change: V755A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130365
AA Change: V71A
SMART Domains Protein: ENSMUSP00000114384
Gene: ENSMUSG00000014418
AA Change: V71A

DomainStartEndE-ValueType
low complexity region 92 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138480
Predicted Effect probably benign
Transcript: ENSMUST00000142663
SMART Domains Protein: ENSMUSP00000122887
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 8e-8 SMART
Blast:WD40 63 103 9e-20 BLAST
Blast:WD40 111 151 2e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145776
Predicted Effect unknown
Transcript: ENSMUST00000153789
AA Change: V220A
SMART Domains Protein: ENSMUSP00000119876
Gene: ENSMUSG00000014418
AA Change: V220A

DomainStartEndE-ValueType
low complexity region 241 252 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 449 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157026
Predicted Effect probably benign
Transcript: ENSMUST00000211347
Predicted Effect probably benign
Transcript: ENSMUST00000211571
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Hps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hps5 APN 7 46775938 missense probably damaging 1.00
IGL00543:Hps5 APN 7 46778073 missense probably benign 0.37
IGL01090:Hps5 APN 7 46788327 missense probably benign 0.02
IGL01351:Hps5 APN 7 46761432 missense probably damaging 1.00
IGL01479:Hps5 APN 7 46762942 critical splice donor site probably null
IGL02056:Hps5 APN 7 46788182 missense probably damaging 1.00
IGL02117:Hps5 APN 7 46783516 missense probably damaging 1.00
IGL02210:Hps5 APN 7 46786570 missense probably benign 0.03
IGL02967:Hps5 APN 7 46769380 missense possibly damaging 0.69
IGL03046:Hps5 APN 7 46777039 splice site probably benign
IGL03187:Hps5 APN 7 46773207 missense probably damaging 1.00
IGL03259:Hps5 APN 7 46763102 missense probably damaging 0.99
dorian_gray UTSW 7 46784145 unclassified probably benign
smoky UTSW 7 46769351 nonsense probably null
Titan UTSW 7 46783469 critical splice donor site probably null
toffee UTSW 7 46777075 intron probably benign
wombat UTSW 7 46783634 missense probably damaging 1.00
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0141:Hps5 UTSW 7 46789181 missense probably damaging 1.00
R0383:Hps5 UTSW 7 46769288 splice site probably null
R0402:Hps5 UTSW 7 46790909 splice site probably benign
R0684:Hps5 UTSW 7 46783469 critical splice donor site probably null
R1159:Hps5 UTSW 7 46772554 splice site probably null
R1938:Hps5 UTSW 7 46773267 missense probably damaging 1.00
R2058:Hps5 UTSW 7 46768051 missense probably damaging 1.00
R3613:Hps5 UTSW 7 46776874 critical splice donor site probably null
R3881:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3882:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3914:Hps5 UTSW 7 46783526 missense probably damaging 1.00
R4095:Hps5 UTSW 7 46775794 missense probably benign 0.01
R4457:Hps5 UTSW 7 46783613 missense probably benign 0.00
R4739:Hps5 UTSW 7 46786589 missense probably benign
R4838:Hps5 UTSW 7 46788354 missense probably damaging 1.00
R4934:Hps5 UTSW 7 46769351 nonsense probably null
R5876:Hps5 UTSW 7 46789196 missense probably damaging 1.00
R6056:Hps5 UTSW 7 46767097 missense probably benign 0.00
R6878:Hps5 UTSW 7 46783634 missense probably damaging 1.00
R7912:Hps5 UTSW 7 46769402 missense probably benign 0.15
R7977:Hps5 UTSW 7 46769051 missense probably benign 0.03
R7987:Hps5 UTSW 7 46769051 missense probably benign 0.03
R8131:Hps5 UTSW 7 46771888 missense probably benign 0.00
R8243:Hps5 UTSW 7 46786642 missense probably damaging 1.00
R8245:Hps5 UTSW 7 46769061 nonsense probably null
X0021:Hps5 UTSW 7 46763093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATCTTTTGTCAAGTGCCCAC -3'
(R):5'- TCACTGAAGAAGCTGGAGGTC -3'

Sequencing Primer
(F):5'- GCAATGCCACCTGATAGTTAC -3'
(R):5'- GTCAGATAACCTGTGACCCTGTAAG -3'
Posted On2017-10-10