Incidental Mutation 'R6129:Adgrl1'
ID487575
Institutional Source Beutler Lab
Gene Symbol Adgrl1
Ensembl Gene ENSMUSG00000013033
Gene Nameadhesion G protein-coupled receptor L1
Synonymslectomedin-2, Lec2, Lphn1, 2900070I05Rik
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6129 (G1)
Quality Score169.009
Status Validated
Chromosome8
Chromosomal Location83900105-83941954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83918987 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 80 (N80D)
Ref Sequence ENSEMBL: ENSMUSP00000119100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000124355] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]
Predicted Effect probably damaging
Transcript: ENSMUST00000045393
AA Change: N80D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033
AA Change: N80D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 6.6e-23 PFAM
OLF 142 398 8.5e-138 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 1.4e-23 SMART
low complexity region 579 591 N/A INTRINSIC
low complexity region 747 758 N/A INTRINSIC
GPS 797 849 3.5e-27 SMART
Pfam:7tm_2 856 1092 5.3e-66 PFAM
Pfam:Latrophilin 1112 1470 1.7e-177 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124355
AA Change: N80D

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033
AA Change: N80D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132500
AA Change: N80D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033
AA Change: N80D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.6e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 3.4e-68 PFAM
Pfam:Latrophilin 1146 1511 6.4e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139575
Predicted Effect probably damaging
Transcript: ENSMUST00000141158
AA Change: N80D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033
AA Change: N80D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 3.4e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 4.5e-68 PFAM
Pfam:Latrophilin 1107 1466 1.1e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152978
AA Change: N80D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033
AA Change: N80D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 2.1e-25 PFAM
OLF 142 398 1.39e-135 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 2.26e-21 SMART
Pfam:GAIN 544 773 4.1e-59 PFAM
GPS 797 849 5.64e-25 SMART
Pfam:7tm_2 856 1092 2.3e-69 PFAM
Pfam:Latrophilin 1112 1516 7.3e-136 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Adgrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adgrl1 APN 8 83937703 missense probably damaging 0.98
IGL01413:Adgrl1 APN 8 83929857 missense probably damaging 1.00
IGL02020:Adgrl1 APN 8 83932948 missense probably benign 0.09
IGL02422:Adgrl1 APN 8 83937486 missense probably damaging 1.00
IGL03065:Adgrl1 APN 8 83938514 missense possibly damaging 0.95
IGL03169:Adgrl1 APN 8 83931995 missense probably damaging 0.97
IGL03237:Adgrl1 APN 8 83929683 splice site probably null
Swiss_rolls UTSW 8 83918922 missense probably damaging 0.99
R0375:Adgrl1 UTSW 8 83934901 missense probably damaging 0.99
R0505:Adgrl1 UTSW 8 83934650 splice site probably benign
R0681:Adgrl1 UTSW 8 83934650 splice site probably benign
R0964:Adgrl1 UTSW 8 83934412 splice site probably benign
R1182:Adgrl1 UTSW 8 83929822 missense probably damaging 1.00
R1373:Adgrl1 UTSW 8 83937763 missense probably benign 0.23
R1475:Adgrl1 UTSW 8 83938350 missense possibly damaging 0.60
R1610:Adgrl1 UTSW 8 83932373 missense probably benign 0.16
R1778:Adgrl1 UTSW 8 83930037 missense probably damaging 1.00
R2089:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2300:Adgrl1 UTSW 8 83930117 nonsense probably null
R2403:Adgrl1 UTSW 8 83931241 missense probably benign 0.01
R2935:Adgrl1 UTSW 8 83934560 missense probably damaging 1.00
R3772:Adgrl1 UTSW 8 83923004 missense possibly damaging 0.59
R4191:Adgrl1 UTSW 8 83938940 missense probably benign 0.29
R4393:Adgrl1 UTSW 8 83938593 missense probably benign 0.01
R4406:Adgrl1 UTSW 8 83930042 missense probably damaging 1.00
R4445:Adgrl1 UTSW 8 83934860 missense probably damaging 1.00
R4782:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R4799:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R5214:Adgrl1 UTSW 8 83915573 splice site probably null
R5242:Adgrl1 UTSW 8 83931082 missense possibly damaging 0.47
R5409:Adgrl1 UTSW 8 83929742 missense probably damaging 1.00
R5522:Adgrl1 UTSW 8 83923075 missense possibly damaging 0.93
R5607:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5608:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5652:Adgrl1 UTSW 8 83929815 missense probably damaging 1.00
R5655:Adgrl1 UTSW 8 83938601 missense possibly damaging 0.89
R5919:Adgrl1 UTSW 8 83932610 missense probably damaging 1.00
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6221:Adgrl1 UTSW 8 83937687 nonsense probably null
R7142:Adgrl1 UTSW 8 83937200 missense probably benign 0.38
R7181:Adgrl1 UTSW 8 83926249 splice site probably null
R7238:Adgrl1 UTSW 8 83939064 missense probably damaging 0.99
R7547:Adgrl1 UTSW 8 83938884 missense probably benign 0.00
R7709:Adgrl1 UTSW 8 83938988 missense probably benign 0.03
R7741:Adgrl1 UTSW 8 83929714 missense probably damaging 1.00
R7852:Adgrl1 UTSW 8 83935558 missense probably damaging 1.00
R7866:Adgrl1 UTSW 8 83937935 critical splice donor site probably null
R8146:Adgrl1 UTSW 8 83930989 missense possibly damaging 0.64
R8314:Adgrl1 UTSW 8 83938389 missense probably damaging 1.00
RF007:Adgrl1 UTSW 8 83934772 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACACTGTCTACAACTGTTCTGC -3'
(R):5'- TCTGTGAGCTCCTACCTGAAC -3'

Sequencing Primer
(F):5'- TGTTCTGCAGGCCTGAGC -3'
(R):5'- GCAAGCATCTATGGCACTGGTTAC -3'
Posted On2017-10-10