Incidental Mutation 'R6129:Stk10'
ID487580
Institutional Source Beutler Lab
Gene Symbol Stk10
Ensembl Gene ENSMUSG00000020272
Gene Nameserine/threonine kinase 10
SynonymsGek1, Lok
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6129 (G1)
Quality Score172.009
Status Validated
Chromosome11
Chromosomal Location32533305-32624587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32615871 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 872 (C872S)
Ref Sequence ENSEMBL: ENSMUSP00000099885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102821]
Predicted Effect probably damaging
Transcript: ENSMUST00000102821
AA Change: C872S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: C872S

DomainStartEndE-ValueType
S_TKc 36 294 8.66e-92 SMART
low complexity region 316 334 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
Pfam:PKK 586 724 1.9e-41 PFAM
Pfam:PKK 754 894 2.2e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Stk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Stk10 APN 11 32577740 missense probably benign 0.33
IGL01285:Stk10 APN 11 32610653 missense possibly damaging 0.91
IGL01983:Stk10 APN 11 32589460 missense probably benign 0.05
IGL03177:Stk10 APN 11 32614592 missense probably damaging 1.00
IGL03183:Stk10 APN 11 32604143 missense possibly damaging 0.50
legacy UTSW 11 32604166 nonsense probably null
mignon UTSW 11 32587363 missense probably damaging 1.00
FR4976:Stk10 UTSW 11 32614520 critical splice acceptor site probably benign
R0003:Stk10 UTSW 11 32589460 missense probably benign 0.05
R0008:Stk10 UTSW 11 32587305 splice site probably benign
R0056:Stk10 UTSW 11 32617851 missense possibly damaging 0.95
R0076:Stk10 UTSW 11 32603722 missense probably benign
R0227:Stk10 UTSW 11 32617859 missense probably damaging 1.00
R0440:Stk10 UTSW 11 32604190 missense probably damaging 1.00
R0454:Stk10 UTSW 11 32596724 missense probably damaging 0.99
R0481:Stk10 UTSW 11 32614708 missense probably damaging 1.00
R0504:Stk10 UTSW 11 32617882 missense probably benign 0.04
R0790:Stk10 UTSW 11 32598653 missense probably benign 0.00
R1439:Stk10 UTSW 11 32617919 missense probably damaging 0.98
R1539:Stk10 UTSW 11 32533440 missense possibly damaging 0.85
R1770:Stk10 UTSW 11 32622464 missense possibly damaging 0.94
R4304:Stk10 UTSW 11 32610634 missense probably damaging 0.97
R4430:Stk10 UTSW 11 32533552 missense possibly damaging 0.81
R4702:Stk10 UTSW 11 32555172 missense probably benign 0.28
R4797:Stk10 UTSW 11 32598471 missense probably benign 0.01
R5447:Stk10 UTSW 11 32604166 nonsense probably null
R5801:Stk10 UTSW 11 32596748 missense probably benign 0.01
R5802:Stk10 UTSW 11 32596748 missense probably benign 0.01
R6154:Stk10 UTSW 11 32603654 splice site probably null
R6175:Stk10 UTSW 11 32603761 missense possibly damaging 0.46
R6185:Stk10 UTSW 11 32577749 missense probably benign 0.13
R6520:Stk10 UTSW 11 32588839 missense probably damaging 1.00
R6824:Stk10 UTSW 11 32587363 missense probably damaging 1.00
R7259:Stk10 UTSW 11 32598497 missense probably benign 0.00
X0027:Stk10 UTSW 11 32587361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGTAGTGAGAGCAGAACCTG -3'
(R):5'- GTCCAGTCTAACAGCCAGAG -3'

Sequencing Primer
(F):5'- GCTGAACTAGGCAAAGTCCCG -3'
(R):5'- TCCAGTCTAACAGCCAGAGAGTAG -3'
Posted On2017-10-10