Mutagenetix > Incidental Mutation

Incidental Mutation 'R6129:Lrrn3'

487587

Institutional Source

Beutler Lab

Gene Symbol

Lrrn3

Ensembl Gene

ENSMUSG00000036295

Gene Name

leucine rich repeat protein 3, neuronal

Synonyms

NLRR-3

MMRRC Submission

044276-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R6129 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41451668-41486431 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 41453788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 177 (Q177*)

Ref Sequence

ENSEMBL: ENSMUSP00000043818 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]

AlphaFold

Q8CBC6

Predicted Effect

probably null
Transcript: ENSMUST00000043884
AA Change: Q177*

SMART Domains

Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: Q177*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	28	73	9.17e-4	SMART
LRR	115	138	2.63e0	SMART
LRR_TYP	139	162	1.5e-4	SMART
LRR	163	186	7.55e-1	SMART
LRR	187	210	1.76e1	SMART
LRR	211	234	1.62e1	SMART
LRR	235	258	5.11e0	SMART
LRR	260	282	3.18e1	SMART
LRR	333	356	4.44e0	SMART
LRRCT	368	420	3.7e-5	SMART
IGc2	435	503	5.04e-9	SMART
FN3	521	602	3.49e0	SMART
transmembrane domain	626	648	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132121

SMART Domains

Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134965

SMART Domains

Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (54/54)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	A	11: 69,898,311	Y354F	probably damaging	Het
Aatk	C	T	11: 120,021,533	G29S	probably damaging	Het
Acsm2	G	A	7: 119,591,247		probably null	Het
Adgrl1	A	G	8: 83,918,987	N80D	probably damaging	Het
Ankrd34a	T	A	3: 96,597,958	Y159*	probably null	Het
BC067074	T	A	13: 113,368,806	Y2156*	probably null	Het
Bcl2l2	G	A	14: 54,884,745	V122M	possibly damaging	Het
Brms1l	A	G	12: 55,868,185	H293R	probably benign	Het
Clec4b1	A	G	6: 123,068,502	T94A	possibly damaging	Het
Crim1	A	G	17: 78,281,309	D271G	probably benign	Het
Csmd2	G	A	4: 128,493,334	G2141S	possibly damaging	Het
Ctnnal1	C	A	4: 56,829,573	A419S	possibly damaging	Het
Cyp27a1	G	A	1: 74,735,692	R264H	probably benign	Het
Cyr61	T	C	3: 145,649,231	I90V	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsc2	T	A	18: 20,045,430	T306S	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ermp1	A	T	19: 29,623,209	Y586N	possibly damaging	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm5114	C	T	7: 39,408,600	A532T	possibly damaging	Het
Gm5431	A	G	11: 48,889,591	L168P	probably damaging	Het
Hao2	T	C	3: 98,880,526	T196A	probably benign	Het
Hdac9	A	C	12: 34,287,475	L669R	probably damaging	Het
Hps5	A	G	7: 46,771,774	V755A	probably benign	Het
Jag2	G	T	12: 112,920,349	Y203*	probably null	Het
Me1	A	T	9: 86,650,956	V151E	probably damaging	Het
Mkx	A	G	18: 6,992,888	V132A	probably damaging	Het
Mycbp2	A	G	14: 103,285,400	S643P	probably benign	Het
Mysm1	C	A	4: 94,967,955	R135L	probably damaging	Het
Nup210l	T	C	3: 90,104,176	F4L	probably benign	Het
Pappa2	A	T	1: 158,714,997	C1773*	probably null	Het
Pcbp3	T	C	10: 76,763,348	E318G	probably damaging	Het
Pcdh12	T	C	18: 38,277,859	K984E	probably damaging	Het
Pcna-ps2	A	G	19: 9,284,015	N213D	possibly damaging	Het
Pde8b	G	A	13: 95,041,959	A509V	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phf7	A	G	14: 31,240,863	Y137H	probably damaging	Het
Pkd1l1	A	G	11: 8,868,543	V1315A	probably benign	Het
Plxnd1	A	G	6: 115,978,174	C571R	probably damaging	Het
Ppp1r12b	C	T	1: 134,892,252	W251*	probably null	Het
Prps1l1	A	G	12: 34,985,330	E148G	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Robo3	A	G	9: 37,423,293	Y592H	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	A	T	11: 50,417,248	L259Q	probably damaging	Het
Rusc2	T	C	4: 43,424,271	F1112S	probably damaging	Het
Sap130	T	C	18: 31,682,091	V622A	possibly damaging	Het
Sptbn4	C	A	7: 27,360,088	C1124F	probably damaging	Het
Stk10	T	A	11: 32,615,871	C872S	probably damaging	Het
Tex15	A	T	8: 33,574,130	N1196I	possibly damaging	Het
Tnxa	A	G	17: 34,800,288		probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zscan4b	T	A	7: 10,901,888	T171S	probably benign	Het

Other mutations in Lrrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Lrrn3	APN	12	41452192	intron	probably benign
IGL02825:Lrrn3	APN	12	41452593	missense	probably damaging	1.00
IGL02927:Lrrn3	APN	12	41453344	missense	probably damaging	1.00
IGL02970:Lrrn3	APN	12	41452360	missense	probably benign
IGL02995:Lrrn3	APN	12	41452217	missense	probably damaging	1.00
IGL02999:Lrrn3	APN	12	41452751	missense	probably benign	0.01
IGL03182:Lrrn3	APN	12	41454021	missense	probably damaging	1.00
IGL03280:Lrrn3	APN	12	41454147	missense	probably damaging	0.97
PIT4469001:Lrrn3	UTSW	12	41453018	missense	probably benign	0.03
R0167:Lrrn3	UTSW	12	41454015	missense	probably damaging	1.00
R0414:Lrrn3	UTSW	12	41453940	missense	probably damaging	1.00
R0787:Lrrn3	UTSW	12	41454231	missense	probably damaging	1.00
R0894:Lrrn3	UTSW	12	41454034	missense	probably damaging	1.00
R1433:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R1610:Lrrn3	UTSW	12	41452993	missense	possibly damaging	0.89
R1834:Lrrn3	UTSW	12	41453518	missense	probably damaging	1.00
R2068:Lrrn3	UTSW	12	41452996	missense	probably damaging	1.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R2871:Lrrn3	UTSW	12	41452723	missense	probably benign	0.00
R3771:Lrrn3	UTSW	12	41452870	missense	probably damaging	1.00
R4408:Lrrn3	UTSW	12	41454042	missense	probably benign	0.04
R4410:Lrrn3	UTSW	12	41452584	missense	possibly damaging	0.74
R4684:Lrrn3	UTSW	12	41454244	missense	possibly damaging	0.75
R4770:Lrrn3	UTSW	12	41452443	missense	probably benign	0.08
R4927:Lrrn3	UTSW	12	41453125	missense	probably damaging	1.00
R5037:Lrrn3	UTSW	12	41453595	missense	probably damaging	1.00
R5482:Lrrn3	UTSW	12	41452387	missense	probably benign	0.01
R5482:Lrrn3	UTSW	12	41452388	missense	probably damaging	0.96
R5667:Lrrn3	UTSW	12	41452298	missense	possibly damaging	0.77
R6022:Lrrn3	UTSW	12	41453430	missense	probably damaging	0.96
R6087:Lrrn3	UTSW	12	41453535	missense	possibly damaging	0.84
R6309:Lrrn3	UTSW	12	41453206	missense	probably damaging	1.00
R7449:Lrrn3	UTSW	12	41453488	missense	probably damaging	1.00
R7555:Lrrn3	UTSW	12	41452911	missense	probably benign	0.01
R7560:Lrrn3	UTSW	12	41452713	missense	possibly damaging	0.93
R8059:Lrrn3	UTSW	12	41454217	missense	probably benign	0.22
R8134:Lrrn3	UTSW	12	41453048	missense	probably damaging	1.00
R8798:Lrrn3	UTSW	12	41453175	missense	possibly damaging	0.61
R9308:Lrrn3	UTSW	12	41453946	missense	probably damaging	1.00
R9318:Lrrn3	UTSW	12	41453244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGTGCAACCTGGGGAAC -3'
(R):5'- TCTGTGTACCTAGAGGAAAACAAGC -3'

Sequencing Primer
(F):5'- AAAGGAGATGCTTTCTAGGTTCTCC -3'
(R):5'- CTAACTGAGCTGCCGGAAAAGTG -3'

Posted On

2017-10-10