Incidental Mutation 'R6129:Lrrn3'
ID487587
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Nameleucine rich repeat protein 3, neuronal
SynonymsNLRR-3
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location41451668-41486431 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 41453788 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 177 (Q177*)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect probably null
Transcript: ENSMUST00000043884
AA Change: Q177*
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: Q177*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41452192 intron probably benign
IGL02825:Lrrn3 APN 12 41452593 missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41453344 missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41452360 missense probably benign
IGL02995:Lrrn3 APN 12 41452217 missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41452751 missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41454021 missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41454147 missense probably damaging 0.97
PIT4469001:Lrrn3 UTSW 12 41453018 missense probably benign 0.03
R0167:Lrrn3 UTSW 12 41454015 missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41453940 missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41454231 missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41454034 missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R1610:Lrrn3 UTSW 12 41452993 missense possibly damaging 0.89
R1834:Lrrn3 UTSW 12 41453518 missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41452996 missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R3771:Lrrn3 UTSW 12 41452870 missense probably damaging 1.00
R4408:Lrrn3 UTSW 12 41454042 missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41454244 missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41452443 missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41453125 missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41453595 missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41452387 missense probably benign 0.01
R5482:Lrrn3 UTSW 12 41452388 missense probably damaging 0.96
R5667:Lrrn3 UTSW 12 41452298 missense possibly damaging 0.77
R6022:Lrrn3 UTSW 12 41453430 missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41453535 missense possibly damaging 0.84
R6309:Lrrn3 UTSW 12 41453206 missense probably damaging 1.00
R7449:Lrrn3 UTSW 12 41453488 missense probably damaging 1.00
R7555:Lrrn3 UTSW 12 41452911 missense probably benign 0.01
R7560:Lrrn3 UTSW 12 41452713 missense possibly damaging 0.93
R8059:Lrrn3 UTSW 12 41454217 missense probably benign 0.22
R8134:Lrrn3 UTSW 12 41453048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGTGCAACCTGGGGAAC -3'
(R):5'- TCTGTGTACCTAGAGGAAAACAAGC -3'

Sequencing Primer
(F):5'- AAAGGAGATGCTTTCTAGGTTCTCC -3'
(R):5'- CTAACTGAGCTGCCGGAAAAGTG -3'
Posted On2017-10-10