Incidental Mutation 'R6129:Brms1l'
ID487588
Institutional Source Beutler Lab
Gene Symbol Brms1l
Ensembl Gene ENSMUSG00000012076
Gene Namebreast cancer metastasis-suppressor 1-like
SynonymsD12Ertd407e, BRMS1, 0710008O11Rik
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55836324-55869736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55868185 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 293 (H293R)
Ref Sequence ENSEMBL: ENSMUSP00000082500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]
Predicted Effect probably benign
Transcript: ENSMUST00000059250
AA Change: H293R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076
AA Change: H293R

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Sds3 61 217 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219575
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Brms1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Brms1l APN 12 55845326 missense probably benign 0.15
IGL00951:Brms1l APN 12 55866049 missense possibly damaging 0.54
IGL02199:Brms1l APN 12 55861172 critical splice donor site probably benign
IGL02669:Brms1l APN 12 55841616 missense probably damaging 1.00
IGL03158:Brms1l APN 12 55836535 missense possibly damaging 0.83
IGL03184:Brms1l APN 12 55868277 makesense probably null
R0445:Brms1l UTSW 12 55861406 nonsense probably null
R0568:Brms1l UTSW 12 55861388 critical splice acceptor site probably null
R0942:Brms1l UTSW 12 55865957 missense probably benign 0.00
R0968:Brms1l UTSW 12 55866013 missense possibly damaging 0.73
R1240:Brms1l UTSW 12 55844508 missense probably damaging 1.00
R1580:Brms1l UTSW 12 55868222 missense probably damaging 1.00
R1694:Brms1l UTSW 12 55841600 missense probably damaging 1.00
R1926:Brms1l UTSW 12 55863161 missense possibly damaging 0.69
R4626:Brms1l UTSW 12 55863173 missense probably benign 0.01
R4669:Brms1l UTSW 12 55841571 missense possibly damaging 0.83
R4987:Brms1l UTSW 12 55866015 missense probably benign 0.15
R6010:Brms1l UTSW 12 55868200 missense possibly damaging 0.55
R7429:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7430:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7510:Brms1l UTSW 12 55845322 nonsense probably null
R7543:Brms1l UTSW 12 55868212 missense probably damaging 1.00
R7855:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
R7938:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAAACCGTGTTTCTAAGCTGGTAATC -3'
(R):5'- GCTGAGTGCATTCTCTTGGC -3'

Sequencing Primer
(F):5'- TCTGAAGATTAGTATAAACCGGGTG -3'
(R):5'- GAGTGCATTCTCTTGGCTTCCATG -3'
Posted On2017-10-10