Mutagenetix > Incidental Mutations

Incidental Mutation 'R6129:Brms1l'

487588

Institutional Source

Beutler Lab

Gene Symbol

Brms1l

Ensembl Gene

ENSMUSG00000012076

Gene Name

breast cancer metastasis-suppressor 1-like

Synonyms

D12Ertd407e, BRMS1, 0710008O11Rik

MMRRC Submission

044276-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.926) question?

Stock #

R6129 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55836324-55869736 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55868185 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 293 (H293R)

Ref Sequence

ENSEMBL: ENSMUSP00000082500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]

Predicted Effect

probably benign
Transcript: ENSMUST00000059250
AA Change: H293R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076
AA Change: H293R

Domain	Start	End	E-Value	Type
low complexity region	24	55	N/A	INTRINSIC
Pfam:Sds3	61	217	1.5e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000219419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219575

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	A	11: 69,898,311	Y354F	probably damaging	Het
Aatk	C	T	11: 120,021,533	G29S	probably damaging	Het
Acsm2	G	A	7: 119,591,247		probably null	Het
Adgrl1	A	G	8: 83,918,987	N80D	probably damaging	Het
Ankrd34a	T	A	3: 96,597,958	Y159*	probably null	Het
BC067074	T	A	13: 113,368,806	Y2156*	probably null	Het
Bcl2l2	G	A	14: 54,884,745	V122M	possibly damaging	Het
Clec4b1	A	G	6: 123,068,502	T94A	possibly damaging	Het
Crim1	A	G	17: 78,281,309	D271G	probably benign	Het
Csmd2	G	A	4: 128,493,334	G2141S	possibly damaging	Het
Ctnnal1	C	A	4: 56,829,573	A419S	possibly damaging	Het
Cyp27a1	G	A	1: 74,735,692	R264H	probably benign	Het
Cyr61	T	C	3: 145,649,231	I90V	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsc2	T	A	18: 20,045,430	T306S	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ermp1	A	T	19: 29,623,209	Y586N	possibly damaging	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm5114	C	T	7: 39,408,600	A532T	possibly damaging	Het
Gm5431	A	G	11: 48,889,591	L168P	probably damaging	Het
Hao2	T	C	3: 98,880,526	T196A	probably benign	Het
Hdac9	A	C	12: 34,287,475	L669R	probably damaging	Het
Hps5	A	G	7: 46,771,774	V755A	probably benign	Het
Jag2	G	T	12: 112,920,349	Y203*	probably null	Het
Lrrn3	G	A	12: 41,453,788	Q177*	probably null	Het
Me1	A	T	9: 86,650,956	V151E	probably damaging	Het
Mkx	A	G	18: 6,992,888	V132A	probably damaging	Het
Mycbp2	A	G	14: 103,285,400	S643P	probably benign	Het
Mysm1	C	A	4: 94,967,955	R135L	probably damaging	Het
Nup210l	T	C	3: 90,104,176	F4L	probably benign	Het
Pappa2	A	T	1: 158,714,997	C1773*	probably null	Het
Pcbp3	T	C	10: 76,763,348	E318G	probably damaging	Het
Pcdh12	T	C	18: 38,277,859	K984E	probably damaging	Het
Pcna-ps2	A	G	19: 9,284,015	N213D	possibly damaging	Het
Pde8b	G	A	13: 95,041,959	A509V	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phf7	A	G	14: 31,240,863	Y137H	probably damaging	Het
Pkd1l1	A	G	11: 8,868,543	V1315A	probably benign	Het
Plxnd1	A	G	6: 115,978,174	C571R	probably damaging	Het
Ppp1r12b	C	T	1: 134,892,252	W251*	probably null	Het
Prps1l1	A	G	12: 34,985,330	E148G	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Robo3	A	G	9: 37,423,293	Y592H	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	A	T	11: 50,417,248	L259Q	probably damaging	Het
Rusc2	T	C	4: 43,424,271	F1112S	probably damaging	Het
Sap130	T	C	18: 31,682,091	V622A	possibly damaging	Het
Sptbn4	C	A	7: 27,360,088	C1124F	probably damaging	Het
Stk10	T	A	11: 32,615,871	C872S	probably damaging	Het
Tex15	A	T	8: 33,574,130	N1196I	possibly damaging	Het
Tnxa	A	G	17: 34,800,288		probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zscan4b	T	A	7: 10,901,888	T171S	probably benign	Het

Other mutations in Brms1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Brms1l	APN	12	55845326	missense	probably benign	0.15
IGL00951:Brms1l	APN	12	55866049	missense	possibly damaging	0.54
IGL02199:Brms1l	APN	12	55861172	critical splice donor site	probably benign
IGL02669:Brms1l	APN	12	55841616	missense	probably damaging	1.00
IGL03158:Brms1l	APN	12	55836535	missense	possibly damaging	0.83
IGL03184:Brms1l	APN	12	55868277	makesense	probably null
R0445:Brms1l	UTSW	12	55861406	nonsense	probably null
R0568:Brms1l	UTSW	12	55861388	critical splice acceptor site	probably null
R0942:Brms1l	UTSW	12	55865957	missense	probably benign	0.00
R0968:Brms1l	UTSW	12	55866013	missense	possibly damaging	0.73
R1240:Brms1l	UTSW	12	55844508	missense	probably damaging	1.00
R1580:Brms1l	UTSW	12	55868222	missense	probably damaging	1.00
R1694:Brms1l	UTSW	12	55841600	missense	probably damaging	1.00
R1926:Brms1l	UTSW	12	55863161	missense	possibly damaging	0.69
R4626:Brms1l	UTSW	12	55863173	missense	probably benign	0.01
R4669:Brms1l	UTSW	12	55841571	missense	possibly damaging	0.83
R4987:Brms1l	UTSW	12	55866015	missense	probably benign	0.15
R6010:Brms1l	UTSW	12	55868200	missense	possibly damaging	0.55
R7429:Brms1l	UTSW	12	55845299	missense	probably damaging	1.00
R7430:Brms1l	UTSW	12	55845299	missense	probably damaging	1.00
R7510:Brms1l	UTSW	12	55845322	nonsense	probably null
R7543:Brms1l	UTSW	12	55868212	missense	probably damaging	1.00
R7855:Brms1l	UTSW	12	55866053	missense	possibly damaging	0.90
R8200:Brms1l	UTSW	12	55844398	missense	probably damaging	1.00
R8376:Brms1l	UTSW	12	55841629	missense	probably benign	0.03
R8532:Brms1l	UTSW	12	55844479	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAACCGTGTTTCTAAGCTGGTAATC -3'
(R):5'- GCTGAGTGCATTCTCTTGGC -3'

Sequencing Primer
(F):5'- TCTGAAGATTAGTATAAACCGGGTG -3'
(R):5'- GAGTGCATTCTCTTGGCTTCCATG -3'

Posted On

2017-10-10