Mutagenetix > Incidental Mutation

Incidental Mutation 'R6129:Jag2'

487589

Institutional Source

Beutler Lab

Gene Symbol

Jag2

Ensembl Gene

ENSMUSG00000002799

Gene Name

jagged 2

Synonyms

Serh, D12Ggc2e

MMRRC Submission

044276-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6129 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112907819-112929776 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 112920349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 203 (Y203*)

Ref Sequence

ENSEMBL: ENSMUSP00000075224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075827]

AlphaFold

Q9QYE5

Predicted Effect

probably null
Transcript: ENSMUST00000075827
AA Change: Y203*

SMART Domains

Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: Y203*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:MNNL	26	105	4.2e-31	PFAM
low complexity region	108	123	N/A	INTRINSIC
DSL	178	240	1.48e-36	SMART
EGF_like	244	274	7.23e1	SMART
EGF	275	305	4.56e0	SMART
EGF_CA	307	345	8.5e-9	SMART
EGF	350	383	4e-5	SMART
EGF_CA	385	421	5.39e-11	SMART
EGF_CA	423	459	3.51e-10	SMART
EGF_CA	461	496	1.01e-10	SMART
EGF_CA	498	534	1.17e-6	SMART
EGF_CA	536	572	6.35e-8	SMART
EGF	588	634	7.53e-1	SMART
EGF_CA	636	672	2.89e-11	SMART
EGF	677	710	3.68e-4	SMART
EGF	715	748	1.32e-5	SMART
EGF	754	787	1.34e-6	SMART
EGF_CA	789	825	2.58e-8	SMART
EGF_CA	827	863	7.23e-12	SMART
VWC	872	949	1.3e-1	SMART
low complexity region	1002	1035	N/A	INTRINSIC
transmembrane domain	1085	1107	N/A	INTRINSIC
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1170	1199	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220771

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221696

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222402

Predicted Effect

probably benign
Transcript: ENSMUST00000223140

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	A	11: 69,898,311	Y354F	probably damaging	Het
Aatk	C	T	11: 120,021,533	G29S	probably damaging	Het
Acsm2	G	A	7: 119,591,247		probably null	Het
Adgrl1	A	G	8: 83,918,987	N80D	probably damaging	Het
Ankrd34a	T	A	3: 96,597,958	Y159*	probably null	Het
BC067074	T	A	13: 113,368,806	Y2156*	probably null	Het
Bcl2l2	G	A	14: 54,884,745	V122M	possibly damaging	Het
Brms1l	A	G	12: 55,868,185	H293R	probably benign	Het
Clec4b1	A	G	6: 123,068,502	T94A	possibly damaging	Het
Crim1	A	G	17: 78,281,309	D271G	probably benign	Het
Csmd2	G	A	4: 128,493,334	G2141S	possibly damaging	Het
Ctnnal1	C	A	4: 56,829,573	A419S	possibly damaging	Het
Cyp27a1	G	A	1: 74,735,692	R264H	probably benign	Het
Cyr61	T	C	3: 145,649,231	I90V	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dsc2	T	A	18: 20,045,430	T306S	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ermp1	A	T	19: 29,623,209	Y586N	possibly damaging	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm5114	C	T	7: 39,408,600	A532T	possibly damaging	Het
Gm5431	A	G	11: 48,889,591	L168P	probably damaging	Het
Hao2	T	C	3: 98,880,526	T196A	probably benign	Het
Hdac9	A	C	12: 34,287,475	L669R	probably damaging	Het
Hps5	A	G	7: 46,771,774	V755A	probably benign	Het
Lrrn3	G	A	12: 41,453,788	Q177*	probably null	Het
Me1	A	T	9: 86,650,956	V151E	probably damaging	Het
Mkx	A	G	18: 6,992,888	V132A	probably damaging	Het
Mycbp2	A	G	14: 103,285,400	S643P	probably benign	Het
Mysm1	C	A	4: 94,967,955	R135L	probably damaging	Het
Nup210l	T	C	3: 90,104,176	F4L	probably benign	Het
Pappa2	A	T	1: 158,714,997	C1773*	probably null	Het
Pcbp3	T	C	10: 76,763,348	E318G	probably damaging	Het
Pcdh12	T	C	18: 38,277,859	K984E	probably damaging	Het
Pcna-ps2	A	G	19: 9,284,015	N213D	possibly damaging	Het
Pde8b	G	A	13: 95,041,959	A509V	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phf7	A	G	14: 31,240,863	Y137H	probably damaging	Het
Pkd1l1	A	G	11: 8,868,543	V1315A	probably benign	Het
Plxnd1	A	G	6: 115,978,174	C571R	probably damaging	Het
Ppp1r12b	C	T	1: 134,892,252	W251*	probably null	Het
Prps1l1	A	G	12: 34,985,330	E148G	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Robo3	A	G	9: 37,423,293	Y592H	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	A	T	11: 50,417,248	L259Q	probably damaging	Het
Rusc2	T	C	4: 43,424,271	F1112S	probably damaging	Het
Sap130	T	C	18: 31,682,091	V622A	possibly damaging	Het
Sptbn4	C	A	7: 27,360,088	C1124F	probably damaging	Het
Stk10	T	A	11: 32,615,871	C872S	probably damaging	Het
Tex15	A	T	8: 33,574,130	N1196I	possibly damaging	Het
Tnxa	A	G	17: 34,800,288		probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zscan4b	T	A	7: 10,901,888	T171S	probably benign	Het

Other mutations in Jag2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Jag2	APN	12	112912718	missense	probably benign	0.20
IGL00954:Jag2	APN	12	112920406	missense	possibly damaging	0.50
IGL01532:Jag2	APN	12	112914363	missense	probably damaging	0.98
IGL01646:Jag2	APN	12	112916349	missense	possibly damaging	0.65
IGL02243:Jag2	APN	12	112916345	missense	possibly damaging	0.94
IGL02447:Jag2	APN	12	112912612	missense	probably damaging	1.00
IGL02458:Jag2	APN	12	112915993	missense	probably damaging	0.98
IGL02516:Jag2	APN	12	112910566	missense	probably damaging	1.00
IGL02574:Jag2	APN	12	112915511	missense	probably benign	0.32
IGL02629:Jag2	APN	12	112914514	splice site	probably benign
IGL02873:Jag2	APN	12	112910502	missense	probably benign	0.00
IGL03087:Jag2	APN	12	112913948	missense	possibly damaging	0.60
Jaguarundi	UTSW	12	112915469	critical splice donor site	probably null
R0068:Jag2	UTSW	12	112915193	splice site	probably benign
R0310:Jag2	UTSW	12	112913377	unclassified	probably benign
R0963:Jag2	UTSW	12	112915314	missense	probably damaging	1.00
R1188:Jag2	UTSW	12	112920121	nonsense	probably null
R1256:Jag2	UTSW	12	112914419	missense	possibly damaging	0.50
R1298:Jag2	UTSW	12	112916319	unclassified	probably benign
R1317:Jag2	UTSW	12	112914501	missense	probably benign
R2079:Jag2	UTSW	12	112920377	missense	probably damaging	1.00
R2345:Jag2	UTSW	12	112909064	missense	probably damaging	1.00
R4654:Jag2	UTSW	12	112913646	missense	probably benign	0.13
R4782:Jag2	UTSW	12	112914249	missense	probably benign
R4798:Jag2	UTSW	12	112916632	missense	probably benign	0.01
R5242:Jag2	UTSW	12	112916866	missense	probably damaging	0.97
R5350:Jag2	UTSW	12	112908922	missense	possibly damaging	0.77
R5364:Jag2	UTSW	12	112910534	missense	probably damaging	1.00
R6362:Jag2	UTSW	12	112920122	missense	probably damaging	0.97
R6376:Jag2	UTSW	12	112909329	missense	probably benign	0.00
R6819:Jag2	UTSW	12	112910541	missense	probably damaging	1.00
R6844:Jag2	UTSW	12	112916714	missense	probably damaging	1.00
R6968:Jag2	UTSW	12	112914258	missense	probably benign	0.10
R7514:Jag2	UTSW	12	112929052	missense	probably benign	0.19
R7663:Jag2	UTSW	12	112913666	missense	probably damaging	1.00
R7730:Jag2	UTSW	12	112922041	missense	probably damaging	1.00
R7754:Jag2	UTSW	12	112915469	critical splice donor site	probably null
R7828:Jag2	UTSW	12	112913180	missense	probably benign	0.19
R7874:Jag2	UTSW	12	112915946	missense	probably damaging	0.99
R8075:Jag2	UTSW	12	112915274	missense	probably benign	0.05
R8845:Jag2	UTSW	12	112920094	missense	probably damaging	1.00
R8876:Jag2	UTSW	12	112909637	missense	probably benign	0.00
R9117:Jag2	UTSW	12	112913659	nonsense	probably null
R9400:Jag2	UTSW	12	112911988	nonsense	probably null
R9673:Jag2	UTSW	12	112911796	nonsense	probably null
R9688:Jag2	UTSW	12	112908944	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CCTTGTTTACACACGGCTGG -3'
(R):5'- TGCTTAGAGCTTCTGCCCAG -3'

Sequencing Primer
(F):5'- CTTGTTTACACACGGCTGGAACAG -3'
(R):5'- TGTTGCCCCTGAAGCTGC -3'

Posted On

2017-10-10