Incidental Mutation 'R6129:Phf7'
ID487592
Institutional Source Beutler Lab
Gene Symbol Phf7
Ensembl Gene ENSMUSG00000021902
Gene NamePHD finger protein 7
Synonyms1700010P14Rik, 1700006H01Rik
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31237689-31251317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31240863 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 137 (Y137H)
Ref Sequence ENSEMBL: ENSMUSP00000154281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022459] [ENSMUST00000226310] [ENSMUST00000226565] [ENSMUST00000228437] [ENSMUST00000228930]
Predicted Effect probably damaging
Transcript: ENSMUST00000022459
AA Change: Y137H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022459
Gene: ENSMUSG00000021902
AA Change: Y137H

DomainStartEndE-ValueType
PHD 97 145 8.45e-3 SMART
RING 160 207 7.46e-1 SMART
RING 250 300 4.87e0 SMART
PHD 252 301 1.16e0 SMART
Predicted Effect silent
Transcript: ENSMUST00000226310
Predicted Effect probably damaging
Transcript: ENSMUST00000226565
AA Change: Y137H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228140
Predicted Effect probably benign
Transcript: ENSMUST00000228437
Predicted Effect probably damaging
Transcript: ENSMUST00000228930
AA Change: Y137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Phf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0021:Phf7 UTSW 14 31238486 splice site probably benign
R0021:Phf7 UTSW 14 31238486 splice site probably benign
R1331:Phf7 UTSW 14 31240405 nonsense probably null
R1912:Phf7 UTSW 14 31240324 missense possibly damaging 0.64
R5185:Phf7 UTSW 14 31248037 splice site probably null
R7035:Phf7 UTSW 14 31239226 missense probably damaging 1.00
R7358:Phf7 UTSW 14 31241788 missense probably benign 0.01
R7427:Phf7 UTSW 14 31240413 missense possibly damaging 0.83
R7428:Phf7 UTSW 14 31240413 missense possibly damaging 0.83
R7538:Phf7 UTSW 14 31238429 missense probably benign
R7666:Phf7 UTSW 14 31240354 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAAGGAGAAACCCCTGTG -3'
(R):5'- TGTTGCTTCCCAGAATTTCCAG -3'

Sequencing Primer
(F):5'- GGAGAAACCCCTGTGAAACTTC -3'
(R):5'- CCCAGAATTTCCAGTCTGTAGAAAG -3'
Posted On2017-10-10