Incidental Mutation 'R0524:Pask'
ID 48760
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene Name PAS domain containing serine/threonine kinase
Synonyms Paskin
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 93237159-93271244 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93238556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1310 (W1310R)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027492] [ENSMUST00000027493] [ENSMUST00000112942] [ENSMUST00000112944]
AlphaFold Q8CEE6
Predicted Effect probably benign
Transcript: ENSMUST00000027492
SMART Domains Protein: ENSMUSP00000027492
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Mterf 142 172 1.28e2 SMART
Mterf 177 208 1.1e1 SMART
Mterf 213 244 3.89e0 SMART
Mterf 246 274 2.06e2 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000027493
AA Change: W1310R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: W1310R

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112942
SMART Domains Protein: ENSMUSP00000108564
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 7e-55 PDB
Blast:Mterf 142 167 1e-7 BLAST
Blast:Mterf 178 208 8e-13 BLAST
Blast:Mterf 213 235 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112944
SMART Domains Protein: ENSMUSP00000108566
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 6e-54 PDB
Blast:Mterf 142 167 6e-8 BLAST
Blast:Mterf 178 208 2e-12 BLAST
Blast:Mterf 213 235 1e-7 BLAST
low complexity region 253 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189856
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93,238,574 (GRCm39) missense probably benign 0.02
IGL01620:Pask APN 1 93,237,844 (GRCm39) missense possibly damaging 0.87
IGL01959:Pask APN 1 93,262,329 (GRCm39) missense probably benign 0.03
IGL02170:Pask APN 1 93,238,606 (GRCm39) missense possibly damaging 0.69
IGL02499:Pask APN 1 93,248,817 (GRCm39) nonsense probably null
IGL02670:Pask APN 1 93,238,540 (GRCm39) missense probably damaging 1.00
IGL03066:Pask APN 1 93,258,588 (GRCm39) missense probably benign 0.02
IGL03210:Pask APN 1 93,247,714 (GRCm39) missense possibly damaging 0.92
R0472:Pask UTSW 1 93,248,639 (GRCm39) missense probably benign 0.00
R0854:Pask UTSW 1 93,255,156 (GRCm39) missense possibly damaging 0.79
R0854:Pask UTSW 1 93,255,122 (GRCm39) missense probably damaging 0.99
R0854:Pask UTSW 1 93,255,134 (GRCm39) missense probably damaging 1.00
R0863:Pask UTSW 1 93,242,061 (GRCm39) missense probably damaging 1.00
R1052:Pask UTSW 1 93,258,549 (GRCm39) missense probably benign 0.00
R1406:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R1406:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R1831:Pask UTSW 1 93,248,491 (GRCm39) splice site probably null
R1958:Pask UTSW 1 93,249,180 (GRCm39) missense probably benign 0.00
R2143:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2144:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2145:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2509:Pask UTSW 1 93,258,485 (GRCm39) missense possibly damaging 0.62
R2858:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R2899:Pask UTSW 1 93,262,269 (GRCm39) missense probably damaging 1.00
R3545:Pask UTSW 1 93,244,837 (GRCm39) missense probably damaging 1.00
R3778:Pask UTSW 1 93,255,189 (GRCm39) missense probably damaging 1.00
R4111:Pask UTSW 1 93,238,540 (GRCm39) missense probably damaging 1.00
R4514:Pask UTSW 1 93,249,855 (GRCm39) missense probably benign 0.03
R4527:Pask UTSW 1 93,248,224 (GRCm39) missense probably benign
R4580:Pask UTSW 1 93,249,830 (GRCm39) missense probably benign 0.36
R4718:Pask UTSW 1 93,249,918 (GRCm39) missense possibly damaging 0.67
R4775:Pask UTSW 1 93,265,246 (GRCm39) missense probably damaging 0.97
R5036:Pask UTSW 1 93,249,801 (GRCm39) nonsense probably null
R5070:Pask UTSW 1 93,258,596 (GRCm39) missense probably damaging 1.00
R5084:Pask UTSW 1 93,249,819 (GRCm39) missense probably benign
R5151:Pask UTSW 1 93,262,350 (GRCm39) missense probably damaging 1.00
R5196:Pask UTSW 1 93,237,805 (GRCm39) unclassified probably benign
R5643:Pask UTSW 1 93,265,065 (GRCm39) critical splice donor site probably null
R5739:Pask UTSW 1 93,249,778 (GRCm39) missense probably benign
R6126:Pask UTSW 1 93,242,081 (GRCm39) missense probably damaging 1.00
R7161:Pask UTSW 1 93,238,627 (GRCm39) missense probably benign
R7284:Pask UTSW 1 93,248,391 (GRCm39) missense probably benign 0.01
R7289:Pask UTSW 1 93,259,309 (GRCm39) missense probably damaging 1.00
R8277:Pask UTSW 1 93,253,085 (GRCm39) critical splice donor site probably null
R8303:Pask UTSW 1 93,248,286 (GRCm39) missense probably benign 0.10
R8309:Pask UTSW 1 93,240,573 (GRCm39) nonsense probably null
R8321:Pask UTSW 1 93,248,377 (GRCm39) missense possibly damaging 0.85
R8476:Pask UTSW 1 93,249,361 (GRCm39) missense probably benign 0.00
R8814:Pask UTSW 1 93,248,307 (GRCm39) missense probably benign 0.00
R9061:Pask UTSW 1 93,253,191 (GRCm39) nonsense probably null
R9198:Pask UTSW 1 93,265,205 (GRCm39) missense possibly damaging 0.72
R9406:Pask UTSW 1 93,251,987 (GRCm39) missense probably benign 0.02
R9578:Pask UTSW 1 93,263,390 (GRCm39) missense probably benign 0.00
Z1088:Pask UTSW 1 93,244,523 (GRCm39) missense probably damaging 1.00
Z1177:Pask UTSW 1 93,263,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCTTTGGACCAGACAACTGAC -3'
(R):5'- TGGAGTTGACGGGCTCATAAATGC -3'

Sequencing Primer
(F):5'- CTCCTAGCCAGGGCTATTATAAG -3'
(R):5'- CATTTCCTGAGTATATCAGGCCAG -3'
Posted On 2013-06-12