Mutagenetix > Incidental Mutation

Incidental Mutation 'R6183:Rgl1'

487607

Institutional Source

Beutler Lab

Gene Symbol

Rgl1

Ensembl Gene

ENSMUSG00000026482

Gene Name

ral guanine nucleotide dissociation stimulator,-like 1

Synonyms

Rgl

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

152516760-152766351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 152586570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 60 (E60K)

Ref Sequence

ENSEMBL: ENSMUSP00000107488 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859] [ENSMUST00000149536]

AlphaFold

Q60695

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027760
AA Change: E62K

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: E62K

Domain	Start	End	E-Value	Type
RasGEFN	64	196	5.86e-39	SMART
RasGEF	228	502	9.56e-116	SMART
Blast:RasGEF	522	582	6e-8	BLAST
low complexity region	585	596	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
RA	648	735	1.7e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111857
AA Change: E60K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: E60K

Domain	Start	End	E-Value	Type
RasGEFN	62	194	5.86e-39	SMART
RasGEF	226	500	9.56e-116	SMART
Blast:RasGEF	520	580	7e-8	BLAST
low complexity region	583	594	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
RA	646	733	1.7e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111859
AA Change: E97K

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: E97K

Domain	Start	End	E-Value	Type
RasGEFN	99	231	5.86e-39	SMART
RasGEF	263	537	9.56e-116	SMART
Blast:RasGEF	557	617	6e-8	BLAST
low complexity region	620	631	N/A	INTRINSIC
low complexity region	662	672	N/A	INTRINSIC
RA	683	770	1.7e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128251

Predicted Effect

probably benign
Transcript: ENSMUST00000149536

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Rgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Rgl1	APN	1	152571617	missense	probably benign	0.02
IGL01065:Rgl1	APN	1	152519142	missense	probably damaging	1.00
IGL01390:Rgl1	APN	1	152571588	splice site	probably benign
IGL01726:Rgl1	APN	1	152519153	missense	probably damaging	1.00
IGL01837:Rgl1	APN	1	152549150	missense	probably damaging	1.00
IGL02019:Rgl1	APN	1	152528469	splice site	probably benign
IGL02369:Rgl1	APN	1	152533606	missense	probably damaging	1.00
R0240:Rgl1	UTSW	1	152554424	unclassified	probably benign
R0255:Rgl1	UTSW	1	152552596	missense	probably damaging	1.00
R0562:Rgl1	UTSW	1	152539945	missense	probably damaging	1.00
R0648:Rgl1	UTSW	1	152536265	critical splice donor site	probably null
R0734:Rgl1	UTSW	1	152554300	missense	probably damaging	0.98
R1187:Rgl1	UTSW	1	152544433	missense	probably benign	0.14
R1522:Rgl1	UTSW	1	152586533	missense	probably damaging	1.00
R1595:Rgl1	UTSW	1	152675023	splice site	probably benign
R1634:Rgl1	UTSW	1	152524772	missense	probably damaging	1.00
R1661:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1665:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1964:Rgl1	UTSW	1	152549104	missense	probably damaging	1.00
R2291:Rgl1	UTSW	1	152536281	missense	probably damaging	1.00
R4272:Rgl1	UTSW	1	152536289	missense	probably benign	0.13
R4668:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4669:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4747:Rgl1	UTSW	1	152524699	nonsense	probably null
R4830:Rgl1	UTSW	1	152554330	missense	probably benign	0.11
R4853:Rgl1	UTSW	1	152557574	missense	probably benign	0.07
R4969:Rgl1	UTSW	1	152549062	splice site	probably null
R5778:Rgl1	UTSW	1	152552421	missense	probably benign	0.05
R5979:Rgl1	UTSW	1	152557493	missense	probably damaging	1.00
R6180:Rgl1	UTSW	1	152519172	missense	probably damaging	1.00
R6322:Rgl1	UTSW	1	152552435	missense	probably damaging	0.98
R6678:Rgl1	UTSW	1	152524724	missense	probably damaging	1.00
R6759:Rgl1	UTSW	1	152533530	missense	probably damaging	0.99
R6892:Rgl1	UTSW	1	152539940	missense	probably benign	0.00
R7290:Rgl1	UTSW	1	152544395	missense	possibly damaging	0.78
R7363:Rgl1	UTSW	1	152519163	missense	probably damaging	1.00
R7610:Rgl1	UTSW	1	152552620	missense	probably damaging	1.00
R7774:Rgl1	UTSW	1	152554350	missense	probably benign
R8140:Rgl1	UTSW	1	152557501	missense	probably damaging	1.00
R9188:Rgl1	UTSW	1	152519171	missense	probably damaging	1.00
R9190:Rgl1	UTSW	1	152552611	missense	probably damaging	0.96
R9297:Rgl1	UTSW	1	152524703	missense	possibly damaging	0.89
R9318:Rgl1	UTSW	1	152524703	missense	possibly damaging	0.89
R9491:Rgl1	UTSW	1	152549118	missense	probably damaging	1.00
R9570:Rgl1	UTSW	1	152554331	missense	possibly damaging	0.47
R9610:Rgl1	UTSW	1	152521364	missense	probably benign	0.13
R9640:Rgl1	UTSW	1	152521391	missense	probably damaging	1.00
RF005:Rgl1	UTSW	1	152521363	missense	probably benign
Z1088:Rgl1	UTSW	1	152675020	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTCAGAGCCACACCCTTAGG -3'
(R):5'- ACACTGAGTTCACAGAAGCC -3'

Sequencing Primer
(F):5'- GACATCCGCCCTTAGATCG -3'
(R):5'- TGAGTTCACAGAAGCCCACACTG -3'

Posted On

2017-10-10