Mutagenetix > Incidental Mutations

Incidental Mutation 'R6183:Hps3'

487609

Institutional Source

Beutler Lab

Gene Symbol

Hps3

Ensembl Gene

ENSMUSG00000027615

Gene Name

HPS3, biogenesis of lysosomal organelles complex 2 subunit 1

Synonyms

coa, cocoa

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19995945-20035315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20008868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 712 (T712A)

Ref Sequence

ENSEMBL: ENSMUSP00000103957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000012580] [ENSMUST00000108321] [ENSMUST00000108328] [ENSMUST00000108329] [ENSMUST00000173779]

AlphaFold

Q91VB4

Predicted Effect

probably benign
Transcript: ENSMUST00000003714

SMART Domains

Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

Domain	Start	End	E-Value	Type
Pfam:Cu-oxidase_3	90	203	5.1e-8	PFAM
Pfam:Cu-oxidase	220	357	9.6e-11	PFAM
Pfam:Cu-oxidase_2	280	357	1.1e-7	PFAM
Pfam:Cu-oxidase_3	444	556	1.4e-7	PFAM
Blast:FA58C	598	673	3e-6	BLAST
Pfam:Cu-oxidase_3	789	897	2.3e-9	PFAM
Pfam:Cu-oxidase_2	927	1054	8.3e-18	PFAM
low complexity region	1067	1078	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000012580
AA Change: T844A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: T844A

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	212	2.8e-74	PFAM
Pfam:HPS3_Mid	255	640	1.3e-167	PFAM
Pfam:HPS3_C	649	1000	1.8e-175	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108321
AA Change: T712A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: T712A

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	87	5.6e-25	PFAM
Pfam:HPS3_Mid	121	508	4.2e-161	PFAM
Pfam:HPS3_C	517	870	9.2e-199	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108328

SMART Domains

Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617

Domain	Start	End	E-Value	Type
Pfam:Cu-oxidase_3	90	203	5.1e-8	PFAM
Pfam:Cu-oxidase	220	357	9.6e-11	PFAM
Pfam:Cu-oxidase_2	280	357	1.1e-7	PFAM
Pfam:Cu-oxidase_3	444	556	1.4e-7	PFAM
Blast:FA58C	598	673	3e-6	BLAST
Pfam:Cu-oxidase_3	789	897	2.3e-9	PFAM
Pfam:Cu-oxidase_2	927	1054	8.3e-18	PFAM
low complexity region	1067	1078	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108329

SMART Domains

Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617

Domain	Start	End	E-Value	Type
Pfam:Cu-oxidase_3	89	203	8.7e-8	PFAM
Pfam:Cu-oxidase	220	357	7.8e-12	PFAM
Pfam:Cu-oxidase_2	242	356	2.1e-7	PFAM
Pfam:Cu-oxidase_3	445	555	4.4e-7	PFAM
Blast:FA58C	599	674	3e-6	BLAST
Pfam:Cu-oxidase_3	793	898	6.1e-9	PFAM
Pfam:Cu-oxidase_2	931	1055	5.2e-18	PFAM
low complexity region	1068	1079	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130171

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141308

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151752

Predicted Effect

probably benign
Transcript: ENSMUST00000173779

SMART Domains

Protein: ENSMUSP00000133643
Gene: ENSMUSG00000003617

Domain	Start	End	E-Value	Type
SCOP:d1gw0a3	1	37	7e-5	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Hps3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00545:Hps3	APN	3	20019807	missense	possibly damaging	0.94
IGL00846:Hps3	APN	3	20025792	missense	probably benign	0.00
IGL01320:Hps3	APN	3	20030469	missense	probably benign	0.12
IGL01364:Hps3	APN	3	20003305	missense	possibly damaging	0.58
IGL01751:Hps3	APN	3	20010966	missense	probably damaging	1.00
IGL01843:Hps3	APN	3	20029001	missense	probably benign	0.05
IGL02294:Hps3	APN	3	20014048	missense	probably damaging	1.00
IGL02581:Hps3	APN	3	20003221	intron	probably benign
Blue	UTSW	3	20030796	missense	probably damaging	1.00
earl_grey	UTSW	3	20017173	intron	probably benign
gandalf	UTSW	3	20012796	nonsense	probably null
pam_gray	UTSW	3	20017173	intron	probably benign
R0107:Hps3	UTSW	3	20030796	missense	probably damaging	1.00
R0245:Hps3	UTSW	3	20012796	nonsense	probably null
R0421:Hps3	UTSW	3	20029316	missense	probably benign	0.00
R0524:Hps3	UTSW	3	20012776	missense	probably damaging	1.00
R0763:Hps3	UTSW	3	20003279	missense	probably damaging	1.00
R1795:Hps3	UTSW	3	20012695	critical splice donor site	probably null
R1864:Hps3	UTSW	3	20019959	critical splice acceptor site	probably null
R2029:Hps3	UTSW	3	20030527	missense	probably benign	0.01
R2101:Hps3	UTSW	3	20012783	missense	possibly damaging	0.95
R2221:Hps3	UTSW	3	20002363	missense	probably benign
R2268:Hps3	UTSW	3	20012935	splice site	probably benign
R2520:Hps3	UTSW	3	20029030	missense	probably damaging	1.00
R3809:Hps3	UTSW	3	20018812	missense	probably damaging	1.00
R3888:Hps3	UTSW	3	20003223	critical splice donor site	probably null
R3942:Hps3	UTSW	3	19996939	missense	probably damaging	1.00
R4022:Hps3	UTSW	3	20035261	missense	possibly damaging	0.69
R4156:Hps3	UTSW	3	20029229	missense	probably damaging	1.00
R4739:Hps3	UTSW	3	20030410	critical splice acceptor site	probably null
R4823:Hps3	UTSW	3	20012726	missense	probably benign	0.03
R4912:Hps3	UTSW	3	20014173	missense	probably damaging	1.00
R5307:Hps3	UTSW	3	20012701	missense	possibly damaging	0.89
R5859:Hps3	UTSW	3	20008870	missense	probably benign	0.02
R6140:Hps3	UTSW	3	19996987	missense	probably damaging	1.00
R6971:Hps3	UTSW	3	20011535	missense	probably damaging	1.00
R6981:Hps3	UTSW	3	20022820	missense	probably damaging	1.00
R7120:Hps3	UTSW	3	20011541	missense	probably damaging	1.00
R7146:Hps3	UTSW	3	20008886	missense	probably damaging	1.00
R7223:Hps3	UTSW	3	20030419	missense	probably benign	0.05
R7448:Hps3	UTSW	3	20035165	missense	probably damaging	0.99
R7452:Hps3	UTSW	3	20011428	missense	probably damaging	1.00
R7560:Hps3	UTSW	3	20030452	missense	probably benign	0.29
R7659:Hps3	UTSW	3	20022814	nonsense	probably null
R7769:Hps3	UTSW	3	20018808	splice site	probably null
R8050:Hps3	UTSW	3	20003328	missense	probably benign
R8242:Hps3	UTSW	3	20014126	missense	possibly damaging	0.59
R8802:Hps3	UTSW	3	20019906	missense	probably damaging	1.00
R8822:Hps3	UTSW	3	20003227	missense	probably benign
R8945:Hps3	UTSW	3	20014060	missense	probably damaging	0.99
R9111:Hps3	UTSW	3	20030411	critical splice acceptor site	probably null
R9131:Hps3	UTSW	3	20029186	missense	probably damaging	0.98
X0021:Hps3	UTSW	3	20030749	missense	probably benign	0.14
X0066:Hps3	UTSW	3	20015988	missense	probably damaging	1.00
Z1177:Hps3	UTSW	3	20008901	missense	probably damaging	1.00

Predicted Primers

Posted On

2017-10-10