Incidental Mutation 'R0524:Nmt2'
List |< first << previous [record 23 of 51] next >> last >|
ID48761
Institutional Source Beutler Lab
Gene Symbol Nmt2
Ensembl Gene ENSMUSG00000026643
Gene NameN-myristoyltransferase 2
SynonymshNMT-2, A930001K02Rik
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location3284212-3328877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3305437 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 69 (W69R)
Ref Sequence ENSEMBL: ENSMUSP00000089085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081932] [ENSMUST00000091504] [ENSMUST00000102989]
Predicted Effect probably benign
Transcript: ENSMUST00000081932
AA Change: M96K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080600
Gene: ENSMUSG00000026643
AA Change: M96K

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 170 327 1e-78 PFAM
Pfam:NMT_C 341 528 2.9e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091504
AA Change: W69R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089085
Gene: ENSMUSG00000026643
AA Change: W69R

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:NMT 124 283 2e-84 PFAM
Pfam:NMT_C 297 484 1.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102989
SMART Domains Protein: ENSMUSP00000100054
Gene: ENSMUSG00000026643

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 137 296 7.8e-85 PFAM
Pfam:NMT_C 310 497 6.4e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155761
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two N-myristoyltransferase proteins. N-terminal myristoylation is a lipid modification that is involved in regulating the function and localization of signaling proteins. The encoded protein catalyzes the addition of a myristoyl group to the N-terminal glycine residue of many signaling proteins, including the human immunodeficiency virus type 1 (HIV-1) proteins, Gag and Nef. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Nmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL00784:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL01871:Nmt2 APN 2 3312674 missense probably damaging 1.00
IGL02617:Nmt2 APN 2 3314713 missense probably benign 0.15
Faul UTSW 2 3305304 intron probably null
ANU05:Nmt2 UTSW 2 3314694 missense probably benign
R0278:Nmt2 UTSW 2 3325387 missense probably benign 0.00
R0743:Nmt2 UTSW 2 3314785 nonsense probably null
R0884:Nmt2 UTSW 2 3314785 nonsense probably null
R1895:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1946:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1957:Nmt2 UTSW 2 3325382 missense possibly damaging 0.95
R2037:Nmt2 UTSW 2 3309581 missense probably damaging 1.00
R2656:Nmt2 UTSW 2 3307013 missense probably benign
R3422:Nmt2 UTSW 2 3284388 missense possibly damaging 0.82
R3835:Nmt2 UTSW 2 3314686 splice site probably benign
R3955:Nmt2 UTSW 2 3312498 missense probably benign 0.00
R4701:Nmt2 UTSW 2 3322641 missense probably benign
R5032:Nmt2 UTSW 2 3284392 missense probably benign
R6373:Nmt2 UTSW 2 3324951 missense probably benign 0.05
R6396:Nmt2 UTSW 2 3314701 missense probably benign 0.18
R6410:Nmt2 UTSW 2 3316178 missense probably damaging 1.00
R6863:Nmt2 UTSW 2 3305304 intron probably null
R6865:Nmt2 UTSW 2 3314729 missense probably damaging 1.00
R7100:Nmt2 UTSW 2 3312913 missense probably benign
R7139:Nmt2 UTSW 2 3284315 missense probably benign 0.01
R7516:Nmt2 UTSW 2 3312730 missense probably damaging 1.00
X0067:Nmt2 UTSW 2 3324961 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGTGTTTACAGCCTCCCTGAAG -3'
(R):5'- TCTGCCAACATAGGACCAGAAGGAC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtAGCATCTCATTTC -3'
(R):5'- ATGATGGATGACCACTGCAG -3'
Posted On2013-06-12