Incidental Mutation 'R6183:Dennd4b'
ID 487610
Institutional Source Beutler Lab
Gene Symbol Dennd4b
Ensembl Gene ENSMUSG00000042404
Gene Name DENN/MADD domain containing 4B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R6183 (G1)
Quality Score 125.467
Status Not validated
Chromosome 3
Chromosomal Location 90265185-90280669 bp(+) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAGCAGCAGCAG at 90275568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000098914] [ENSMUST00000129564]
AlphaFold Q3U1Y4
Predicted Effect probably benign
Transcript: ENSMUST00000098914
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129564
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138376
SMART Domains Protein: ENSMUSP00000116003
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
coiled coil region 29 55 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143803
Predicted Effect probably benign
Transcript: ENSMUST00000151648
SMART Domains Protein: ENSMUSP00000121350
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
uDENN 2 57 3.71e-6 SMART
Pfam:DENN 91 157 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156358
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Dennd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dennd4b APN 3 90271207 missense possibly damaging 0.83
IGL00834:Dennd4b APN 3 90279686 critical splice donor site probably null
IGL01124:Dennd4b APN 3 90269074 missense possibly damaging 0.61
IGL01792:Dennd4b APN 3 90279845 missense probably damaging 0.96
IGL01895:Dennd4b APN 3 90275567 missense probably benign 0.00
IGL02533:Dennd4b APN 3 90272310 missense probably benign 0.02
IGL02630:Dennd4b APN 3 90272977 missense probably benign 0.00
R0107:Dennd4b UTSW 3 90272736 missense possibly damaging 0.92
R0143:Dennd4b UTSW 3 90272364 missense probably damaging 1.00
R1079:Dennd4b UTSW 3 90271178 missense probably benign
R1306:Dennd4b UTSW 3 90271165 missense probably benign 0.00
R1525:Dennd4b UTSW 3 90270870 missense probably damaging 0.97
R1756:Dennd4b UTSW 3 90271605 missense probably damaging 1.00
R1959:Dennd4b UTSW 3 90268773 missense probably damaging 1.00
R1976:Dennd4b UTSW 3 90273055 missense probably damaging 1.00
R2184:Dennd4b UTSW 3 90275540 missense probably damaging 1.00
R2296:Dennd4b UTSW 3 90275514 missense probably damaging 1.00
R2406:Dennd4b UTSW 3 90275488 missense probably damaging 1.00
R2408:Dennd4b UTSW 3 90271575 nonsense probably null
R4691:Dennd4b UTSW 3 90272312 missense probably damaging 1.00
R5376:Dennd4b UTSW 3 90278056 missense probably benign 0.00
R5466:Dennd4b UTSW 3 90268500 splice site probably null
R5555:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5556:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5557:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5605:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5617:Dennd4b UTSW 3 90275626 missense probably benign
R5692:Dennd4b UTSW 3 90277783 missense probably damaging 1.00
R5790:Dennd4b UTSW 3 90277450 missense probably damaging 1.00
R5957:Dennd4b UTSW 3 90270965 missense probably damaging 1.00
R6130:Dennd4b UTSW 3 90276259 missense probably damaging 1.00
R6505:Dennd4b UTSW 3 90267611 missense probably damaging 1.00
R6631:Dennd4b UTSW 3 90277732 splice site probably null
R6801:Dennd4b UTSW 3 90268779 missense probably damaging 0.98
R7409:Dennd4b UTSW 3 90273952 missense probably benign 0.15
R7457:Dennd4b UTSW 3 90269315 missense probably benign
R7650:Dennd4b UTSW 3 90268749 nonsense probably null
R8196:Dennd4b UTSW 3 90271597 missense probably damaging 1.00
R8208:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
R8444:Dennd4b UTSW 3 90273952 missense probably benign 0.27
R8502:Dennd4b UTSW 3 90273858 missense probably damaging 0.98
R8735:Dennd4b UTSW 3 90277865 missense probably damaging 1.00
R8933:Dennd4b UTSW 3 90279216 missense probably benign 0.05
R9031:Dennd4b UTSW 3 90270881 missense probably benign
R9335:Dennd4b UTSW 3 90268304 missense probably damaging 1.00
X0024:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
Z1176:Dennd4b UTSW 3 90279495 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAAAGGCATCACTAGGC -3'
(R):5'- AGAAAGGCCCCTACAGTTTCCC -3'

Sequencing Primer
(F):5'- GCATCACTAGGCCATCCTG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On 2017-10-10