Mutagenetix > Incidental Mutations

Incidental Mutation 'R6183:Tas1r1'

487612

Institutional Source

Beutler Lab

Gene Symbol

Tas1r1

Ensembl Gene

ENSMUSG00000028950

Gene Name

taste receptor, type 1, member 1

Synonyms

TR1, T1r1, Gpr70, T1R1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R6183 (G1)

Quality Score

82.0076

Status

Not validated

Chromosome

Chromosomal Location

152027914-152038568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 152032541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 212 (I212T)

Ref Sequence

ENSEMBL: ENSMUSP00000030792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030792] [ENSMUST00000066715] [ENSMUST00000131935] [ENSMUST00000155389]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030792
AA Change: I212T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030792
Gene: ENSMUSG00000028950
AA Change: I212T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	75	456	1.7e-69	PFAM
Pfam:NCD3G	494	546	2.1e-15	PFAM
Pfam:7tm_3	578	815	3.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000066715

SMART Domains

Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952

Domain	Start	End	E-Value	Type
BTB	26	119	1.35e-21	SMART
ZnF_C2H2	284	306	1.64e-1	SMART
ZnF_C2H2	312	332	2.06e1	SMART
ZnF_C2H2	343	365	5.99e-4	SMART
ZnF_C2H2	371	394	9.58e-3	SMART
ZnF_C2H2	400	423	2.49e-1	SMART
ZnF_C2H2	429	452	2.57e-3	SMART
ZnF_C2H2	458	480	9.73e-4	SMART
ZnF_C2H2	486	508	3.21e-4	SMART
ZnF_C2H2	514	537	1.67e-2	SMART
ZnF_C2H2	543	565	1.95e-3	SMART
ZnF_C2H2	571	593	5.67e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123696

Predicted Effect

probably benign
Transcript: ENSMUST00000131935

SMART Domains

Protein: ENSMUSP00000116423
Gene: ENSMUSG00000028952

Domain	Start	End	E-Value	Type
BTB	26	119	1.35e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155389

SMART Domains

Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

Domain	Start	End	E-Value	Type
BTB	26	119	1.35e-21	SMART
ZnF_C2H2	284	306	1.64e-1	SMART
ZnF_C2H2	312	332	2.06e1	SMART
ZnF_C2H2	343	365	5.99e-4	SMART
ZnF_C2H2	371	394	9.58e-3	SMART
low complexity region	403	418	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to umami tastants. Response to sweet tastants is unimpaired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Tas1r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02708:Tas1r1	APN	4	152028340	missense	possibly damaging	0.82
IGL02867:Tas1r1	APN	4	152028278	missense	probably damaging	1.00
R1547:Tas1r1	UTSW	4	152028419	missense	probably damaging	1.00
R1775:Tas1r1	UTSW	4	152038218	nonsense	probably null
R1803:Tas1r1	UTSW	4	152032248	missense	probably damaging	0.99
R2037:Tas1r1	UTSW	4	152028170	missense	probably damaging	1.00
R2083:Tas1r1	UTSW	4	152028391	missense	probably benign	0.02
R3821:Tas1r1	UTSW	4	152034681	missense	probably benign
R3912:Tas1r1	UTSW	4	152031924	missense	probably damaging	0.97
R4227:Tas1r1	UTSW	4	152028272	missense	probably damaging	0.99
R4272:Tas1r1	UTSW	4	152032157	missense	possibly damaging	0.70
R4273:Tas1r1	UTSW	4	152032157	missense	possibly damaging	0.70
R4818:Tas1r1	UTSW	4	152032674	missense	probably benign	0.15
R5567:Tas1r1	UTSW	4	152038325	missense	probably damaging	0.99
R7162:Tas1r1	UTSW	4	152032238	missense	possibly damaging	0.91
R7427:Tas1r1	UTSW	4	152038308	missense	probably benign	0.39
R7535:Tas1r1	UTSW	4	152028362	missense	probably benign	0.06
R7736:Tas1r1	UTSW	4	152032466	missense	probably benign	0.17
R7796:Tas1r1	UTSW	4	152034755	missense	probably benign	0.01
R7921:Tas1r1	UTSW	4	152028661	missense	possibly damaging	0.88
R8078:Tas1r1	UTSW	4	152028346	missense	probably damaging	1.00
R8255:Tas1r1	UTSW	4	152032317	missense	probably benign	0.18
R8412:Tas1r1	UTSW	4	152032576	missense	probably benign
R8799:Tas1r1	UTSW	4	152032251	missense	probably benign	0.00
R8875:Tas1r1	UTSW	4	152028590	missense	probably benign	0.03
R9051:Tas1r1	UTSW	4	152038376	nonsense	probably null
R9393:Tas1r1	UTSW	4	152031956	missense	probably damaging	1.00
Z1177:Tas1r1	UTSW	4	152032214	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCGGTTAGAGAAGACCAC -3'
(R):5'- GAGGGGCAGACTTCATTCAG -3'

Sequencing Primer
(F):5'- GAAGACCACGACCACGGTG -3'
(R):5'- GGGCAGACTTCATTCAGTTCCC -3'

Posted On

2017-10-10