Incidental Mutation 'R6183:Tas1r1'
ID 487612
Institutional Source Beutler Lab
Gene Symbol Tas1r1
Ensembl Gene ENSMUSG00000028950
Gene Name taste receptor, type 1, member 1
Synonyms TR1, T1r1, Gpr70, T1R1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6183 (G1)
Quality Score 82.0076
Status Not validated
Chromosome 4
Chromosomal Location 152027914-152038568 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152032541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 212 (I212T)
Ref Sequence ENSEMBL: ENSMUSP00000030792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030792] [ENSMUST00000066715] [ENSMUST00000131935] [ENSMUST00000155389]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030792
AA Change: I212T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030792
Gene: ENSMUSG00000028950
AA Change: I212T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 456 1.7e-69 PFAM
Pfam:NCD3G 494 546 2.1e-15 PFAM
Pfam:7tm_3 578 815 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066715
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123696
Predicted Effect probably benign
Transcript: ENSMUST00000131935
SMART Domains Protein: ENSMUSP00000116423
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155389
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to umami tastants. Response to sweet tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Tas1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Tas1r1 APN 4 152028340 missense possibly damaging 0.82
IGL02867:Tas1r1 APN 4 152028278 missense probably damaging 1.00
R1547:Tas1r1 UTSW 4 152028419 missense probably damaging 1.00
R1775:Tas1r1 UTSW 4 152038218 nonsense probably null
R1803:Tas1r1 UTSW 4 152032248 missense probably damaging 0.99
R2037:Tas1r1 UTSW 4 152028170 missense probably damaging 1.00
R2083:Tas1r1 UTSW 4 152028391 missense probably benign 0.02
R3821:Tas1r1 UTSW 4 152034681 missense probably benign
R3912:Tas1r1 UTSW 4 152031924 missense probably damaging 0.97
R4227:Tas1r1 UTSW 4 152028272 missense probably damaging 0.99
R4272:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4273:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4818:Tas1r1 UTSW 4 152032674 missense probably benign 0.15
R5567:Tas1r1 UTSW 4 152038325 missense probably damaging 0.99
R7162:Tas1r1 UTSW 4 152032238 missense possibly damaging 0.91
R7427:Tas1r1 UTSW 4 152038308 missense probably benign 0.39
R7535:Tas1r1 UTSW 4 152028362 missense probably benign 0.06
R7736:Tas1r1 UTSW 4 152032466 missense probably benign 0.17
R7796:Tas1r1 UTSW 4 152034755 missense probably benign 0.01
R7921:Tas1r1 UTSW 4 152028661 missense possibly damaging 0.88
R8078:Tas1r1 UTSW 4 152028346 missense probably damaging 1.00
R8255:Tas1r1 UTSW 4 152032317 missense probably benign 0.18
R8412:Tas1r1 UTSW 4 152032576 missense probably benign
R8799:Tas1r1 UTSW 4 152032251 missense probably benign 0.00
R8875:Tas1r1 UTSW 4 152028590 missense probably benign 0.03
R9051:Tas1r1 UTSW 4 152038376 nonsense probably null
R9393:Tas1r1 UTSW 4 152031956 missense probably damaging 1.00
Z1177:Tas1r1 UTSW 4 152032214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCGGTTAGAGAAGACCAC -3'
(R):5'- GAGGGGCAGACTTCATTCAG -3'

Sequencing Primer
(F):5'- GAAGACCACGACCACGGTG -3'
(R):5'- GGGCAGACTTCATTCAGTTCCC -3'
Posted On 2017-10-10