Mutagenetix > Incidental Mutation

Incidental Mutation 'R6183:Vmn2r125'

487613

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r125

Ensembl Gene

ENSMUSG00000096042

Gene Name

vomeronasal 2, receptor 125

Synonyms

Gm20782

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

156349921-156354578 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 156350069 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 50 (D50V)

Ref Sequence

ENSEMBL: ENSMUSP00000094556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096794]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000096794
AA Change: D50V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000094556
Gene: ENSMUSG00000096042
AA Change: D50V

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	9	355	7e-32	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Vmn2r125

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r125	APN	4	156351226	missense	probably benign
IGL00990:Vmn2r125	APN	4	156351383	missense	probably benign	0.00
IGL00990:Vmn2r125	APN	4	156350966	missense	probably benign	0.01
IGL00990:Vmn2r125	APN	4	156350900	missense	probably benign	0.35
IGL00990:Vmn2r125	APN	4	156350899	missense	probably benign
IGL00990:Vmn2r125	APN	4	156351038	missense	probably benign	0.06
IGL00990:Vmn2r125	APN	4	156351037	missense	probably benign	0.16
IGL01018:Vmn2r125	APN	4	156351226	missense	probably benign
IGL01018:Vmn2r125	APN	4	156351038	missense	probably benign	0.06
IGL01018:Vmn2r125	APN	4	156351037	missense	probably benign	0.16
IGL01018:Vmn2r125	APN	4	156350900	missense	probably benign	0.35
IGL01018:Vmn2r125	APN	4	156350899	missense	probably benign
IGL01018:Vmn2r125	APN	4	156350845	missense	probably damaging	1.00
IGL01018:Vmn2r125	APN	4	156350612	splice site	probably benign
IGL02644:Vmn2r125	APN	4	156350999	missense	probably benign	0.01
IGL03144:Vmn2r125	APN	4	156350019	missense	possibly damaging	0.76
BB013:Vmn2r125	UTSW	4	156350693	missense	probably damaging	1.00
FR4342:Vmn2r125	UTSW	4	156350965	missense	probably benign	0.01
R0408:Vmn2r125	UTSW	4	156350858	missense	probably damaging	0.99
R0785:Vmn2r125	UTSW	4	156351101	missense	probably benign
R1185:Vmn2r125	UTSW	4	156351101	missense	probably benign
R1530:Vmn2r125	UTSW	4	156351152	missense	probably damaging	1.00
R1698:Vmn2r125	UTSW	4	156351038	missense	probably benign	0.06
R1780:Vmn2r125	UTSW	4	156351373	missense	probably damaging	1.00
R1977:Vmn2r125	UTSW	4	156354591	splice site	probably null
R2917:Vmn2r125	UTSW	4	156351269	missense	probably benign	0.01
R3428:Vmn2r125	UTSW	4	156350141	missense	probably benign	0.34
R3712:Vmn2r125	UTSW	4	156350124	nonsense	probably null
R4274:Vmn2r125	UTSW	4	156350087	missense	probably benign	0.00
R4575:Vmn2r125	UTSW	4	156349977	missense	probably null	0.30
R4707:Vmn2r125	UTSW	4	156349981	missense	probably damaging	1.00
R5229:Vmn2r125	UTSW	4	156351038	missense	probably benign	0.06
R5504:Vmn2r125	UTSW	4	156351161	missense	possibly damaging	0.81
R5587:Vmn2r125	UTSW	4	156350138	missense	probably damaging	1.00
R5987:Vmn2r125	UTSW	4	156349997	missense	probably damaging	1.00
R6037:Vmn2r125	UTSW	4	156351101	missense	probably benign
R6456:Vmn2r125	UTSW	4	156351062	missense	probably benign	0.41
R7342:Vmn2r125	UTSW	4	156350843	missense	probably damaging	1.00
R7926:Vmn2r125	UTSW	4	156350693	missense	probably damaging	1.00
R8113:Vmn2r125	UTSW	4	156351347	missense	probably damaging	1.00
R8191:Vmn2r125	UTSW	4	156351414	missense	probably damaging	1.00
R8272:Vmn2r125	UTSW	4	156350078	missense	probably damaging	1.00
R8962:Vmn2r125	UTSW	4	156350891	missense	possibly damaging	0.50
R9187:Vmn2r125	UTSW	4	156351259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCAAGGATGGCATTCAGC -3'
(R):5'- CAAGTTTCCTTCTAGGCACCTG -3'

Sequencing Primer
(F):5'- TTCAAACATCTCCCTTAATCATCAC -3'
(R):5'- GAAGAGTCCATTGCCAGT -3'

Posted On

2017-10-10