Incidental Mutation 'R6183:Tbc1d1'
ID 487616
Institutional Source Beutler Lab
Gene Symbol Tbc1d1
Ensembl Gene ENSMUSG00000029174
Gene Name TBC1 domain family, member 1
Synonyms Nob1, Nobq1, 1110062G02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 64156305-64351486 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64275425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 439 (N439D)
Ref Sequence ENSEMBL: ENSMUSP00000112493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043893] [ENSMUST00000101195] [ENSMUST00000119756] [ENSMUST00000121370]
AlphaFold Q60949
Predicted Effect probably damaging
Transcript: ENSMUST00000043893
AA Change: N439D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044577
Gene: ENSMUSG00000029174
AA Change: N439D

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 2e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 2.5e-25 PFAM
TBC 884 1104 3.84e-89 SMART
Blast:TBC 1129 1186 5e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000101195
AA Change: N439D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098756
Gene: ENSMUSG00000029174
AA Change: N439D

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119756
AA Change: N310D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113643
Gene: ENSMUSG00000029174
AA Change: N310D

DomainStartEndE-ValueType
PTB 39 249 5.93e-34 SMART
low complexity region 390 411 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
Pfam:DUF3350 555 610 2.9e-29 PFAM
TBC 662 882 3.84e-89 SMART
Blast:TBC 907 964 4e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121370
AA Change: N439D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112493
Gene: ENSMUSG00000029174
AA Change: N439D

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000147348
AA Change: N2D
SMART Domains Protein: ENSMUSP00000119710
Gene: ENSMUSG00000029174
AA Change: N2D

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 1e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 3.3e-29 PFAM
TBC 884 1086 2.13e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozgyous for a targeted mutation that removes exon 4 exhibit no adverse phenotype. Mice homozygous for a gene trap allele exhibit decreased body weight, resistance to diet-induced obesity, increased fat oxidization and decreased glucose uptake in the muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Tbc1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Tbc1d1 APN 5 64256992 missense probably damaging 1.00
IGL02341:Tbc1d1 APN 5 64275407 missense probably damaging 1.00
IGL02353:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02360:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02963:Tbc1d1 APN 5 64264366 missense probably damaging 1.00
IGL03003:Tbc1d1 APN 5 64316438 missense probably damaging 1.00
Betrayal UTSW 5 64173484 missense probably damaging 1.00
Perfidy UTSW 5 64335277 critical splice acceptor site probably null
R0035:Tbc1d1 UTSW 5 64256737 missense probably damaging 1.00
R0084:Tbc1d1 UTSW 5 64324454 missense probably damaging 0.96
R0321:Tbc1d1 UTSW 5 64339594 missense probably damaging 1.00
R0559:Tbc1d1 UTSW 5 64173793 missense probably damaging 1.00
R1296:Tbc1d1 UTSW 5 64264432 missense probably damaging 1.00
R1922:Tbc1d1 UTSW 5 64311221 missense probably damaging 1.00
R1928:Tbc1d1 UTSW 5 64345300 missense probably damaging 1.00
R2095:Tbc1d1 UTSW 5 64316501 missense probably benign 0.01
R2107:Tbc1d1 UTSW 5 64284705 missense probably benign 0.19
R2253:Tbc1d1 UTSW 5 64284800 missense probably benign 0.00
R3545:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3546:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3547:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R4039:Tbc1d1 UTSW 5 64316428 missense probably damaging 0.99
R4289:Tbc1d1 UTSW 5 64260428 missense probably damaging 1.00
R4380:Tbc1d1 UTSW 5 64333548 missense probably benign 0.29
R4405:Tbc1d1 UTSW 5 64173670 missense possibly damaging 0.93
R4564:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R4722:Tbc1d1 UTSW 5 64263557 missense probably damaging 1.00
R4779:Tbc1d1 UTSW 5 64278046 critical splice donor site probably null
R5256:Tbc1d1 UTSW 5 64282009 missense probably damaging 1.00
R5268:Tbc1d1 UTSW 5 64324567 missense probably damaging 0.99
R5510:Tbc1d1 UTSW 5 64333395 missense probably damaging 1.00
R5547:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5620:Tbc1d1 UTSW 5 64173712 missense probably benign 0.44
R5680:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5874:Tbc1d1 UTSW 5 64349930 makesense probably null
R6002:Tbc1d1 UTSW 5 64333433 missense probably damaging 1.00
R6058:Tbc1d1 UTSW 5 64278009 missense probably damaging 1.00
R6092:Tbc1d1 UTSW 5 64349899 missense probably benign 0.00
R6118:Tbc1d1 UTSW 5 64284037 missense probably damaging 0.98
R6447:Tbc1d1 UTSW 5 64333493 missense probably damaging 1.00
R6824:Tbc1d1 UTSW 5 64256902 missense probably benign 0.02
R6913:Tbc1d1 UTSW 5 64311109 missense probably benign 0.26
R7039:Tbc1d1 UTSW 5 64284757 missense probably benign 0.08
R7150:Tbc1d1 UTSW 5 64173484 missense probably damaging 1.00
R7154:Tbc1d1 UTSW 5 64173813 missense possibly damaging 0.56
R7316:Tbc1d1 UTSW 5 64335277 critical splice acceptor site probably null
R7621:Tbc1d1 UTSW 5 64264330 missense probably damaging 1.00
R7653:Tbc1d1 UTSW 5 64256790 missense probably benign 0.21
R7684:Tbc1d1 UTSW 5 64316486 missense probably benign 0.13
R7816:Tbc1d1 UTSW 5 64349752 missense probably damaging 0.98
R8832:Tbc1d1 UTSW 5 64284677 splice site probably benign
R9027:Tbc1d1 UTSW 5 64257006 missense probably benign 0.01
R9287:Tbc1d1 UTSW 5 64278021 missense probably damaging 1.00
X0064:Tbc1d1 UTSW 5 64275452 missense probably benign 0.04
Z1088:Tbc1d1 UTSW 5 64275393 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCACTCTTAGGGTGACTG -3'
(R):5'- CCGAAATGTCTCTCGCCATC -3'

Sequencing Primer
(F):5'- CACTCTTAGGGTGACTGGTGCC -3'
(R):5'- TCTCCAGCTGTGCAACAATG -3'
Posted On 2017-10-10