Incidental Mutation 'R6183:Ibsp'
ID 487617
Institutional Source Beutler Lab
Gene Symbol Ibsp
Ensembl Gene ENSMUSG00000029306
Gene Name integrin binding sialoprotein
Synonyms Bsp2, bone sialoprotein, BSP
Accession Numbers

Genbank: NM_008318.3

Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 104299171-104311469 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104306030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 78 (E78G)
Ref Sequence ENSEMBL: ENSMUSP00000031246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031246]
AlphaFold Q61711
Predicted Effect possibly damaging
Transcript: ENSMUST00000031246
AA Change: E78G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306
AA Change: E78G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:BSP_II 17 321 2.8e-127 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Ibsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Ibsp APN 5 104310068 missense probably benign 0.27
IGL02317:Ibsp APN 5 104302466 missense probably damaging 1.00
IGL02539:Ibsp APN 5 104302283 missense probably damaging 0.99
IGL03236:Ibsp APN 5 104306005 missense probably benign 0.30
crunch UTSW 5 104309282 missense probably damaging 1.00
I2289:Ibsp UTSW 5 104302487 missense possibly damaging 0.64
PIT4445001:Ibsp UTSW 5 104302304 missense possibly damaging 0.94
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0234:Ibsp UTSW 5 104310069 small deletion probably benign
R0610:Ibsp UTSW 5 104310134 missense probably benign 0.07
R0656:Ibsp UTSW 5 104310020 critical splice acceptor site probably null
R1168:Ibsp UTSW 5 104302152 missense probably damaging 0.99
R1440:Ibsp UTSW 5 104310539 missense unknown
R1569:Ibsp UTSW 5 104310151 missense probably damaging 1.00
R1921:Ibsp UTSW 5 104310212 missense probably damaging 1.00
R2172:Ibsp UTSW 5 104310430 missense probably damaging 1.00
R2879:Ibsp UTSW 5 104310394 missense possibly damaging 0.88
R4399:Ibsp UTSW 5 104309282 missense probably damaging 1.00
R4517:Ibsp UTSW 5 104305997 nonsense probably null
R5417:Ibsp UTSW 5 104310469 missense possibly damaging 0.95
R5575:Ibsp UTSW 5 104310059 missense possibly damaging 0.78
R6273:Ibsp UTSW 5 104310301 missense probably benign 0.15
R6295:Ibsp UTSW 5 104302121 splice site probably null
R7061:Ibsp UTSW 5 104309902 splice site probably null
R7133:Ibsp UTSW 5 104302306 nonsense probably null
R7202:Ibsp UTSW 5 104302161 missense probably benign 0.02
R7205:Ibsp UTSW 5 104310431 missense probably damaging 0.99
R7769:Ibsp UTSW 5 104306005 missense probably benign 0.15
R7769:Ibsp UTSW 5 104310184 missense probably damaging 0.97
R8506:Ibsp UTSW 5 104310081 missense probably damaging 1.00
R8840:Ibsp UTSW 5 104310140 missense probably benign 0.00
R9396:Ibsp UTSW 5 104310431 missense probably damaging 1.00
R9431:Ibsp UTSW 5 104309301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGAAACCCCTCCATAG -3'
(R):5'- CCATGTCTAGGTAGCTTTAACCTC -3'

Sequencing Primer
(F):5'- TGGAAACCCCTCCATAGTTAGC -3'
(R):5'- GGTAGCTTTAACCTCAAATTACAATG -3'
Posted On 2017-10-10