Mutagenetix > Incidental Mutation

Incidental Mutation 'R6183:Clip1'

487618

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6183 (G1)

Quality Score

203.009

Status

Not validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123642604 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 339 (S339P)

Ref Sequence

ENSEMBL: ENSMUSP00000107192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]

AlphaFold

Q922J3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031382
AA Change: S339P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: S339P

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000063905
AA Change: S339P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: S339P

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111561
AA Change: S339P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: S339P

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111564
AA Change: S339P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: S339P

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111566
AA Change: S339P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: S339P

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000137363
AA Change: S91P

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: S91P

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144121

SMART Domains

Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
CAP_GLY	37	102	1.05e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149410

SMART Domains

Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
low complexity region	26	32	N/A	INTRINSIC
CAP_GLY	60	125	1.05e-31	SMART
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	334	458	N/A	INTRINSIC
coiled coil region	504	543	N/A	INTRINSIC
coiled coil region	575	827	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123579491	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123630681	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7015:Clip1	UTSW	5	123613612	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123613794	missense
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123583385	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8511:Clip1	UTSW	5	123653906	missense	possibly damaging	0.50
R8731:Clip1	UTSW	5	123614693	missense
R8889:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R8892:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123614582	missense
R9106:Clip1	UTSW	5	123615160	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123583336	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123579378	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123646274	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123613123	missense
R9752:Clip1	UTSW	5	123621946	missense	probably damaging	1.00
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTCTTCACCTGGTCATGCC -3'
(R):5'- GAACTTCGCTGTGAGCTTGTTTATC -3'

Sequencing Primer
(F):5'- TGGTCATGCCCATCTCGG -3'
(R):5'- CGCTGTGAGCTTGTTTATCCATGC -3'

Posted On

2017-10-10