Incidental Mutation 'R6183:Prokr1'
ID 487620
Institutional Source Beutler Lab
Gene Symbol Prokr1
Ensembl Gene ENSMUSG00000049409
Gene Name prokineticin receptor 1
Synonyms Pkr1, Gpr73, EG-VEGFR1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6183 (G1)
Quality Score 179.009
Status Not validated
Chromosome 6
Chromosomal Location 87578591-87590743 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87588852 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 4 (T4A)
Ref Sequence ENSEMBL: ENSMUSP00000145476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050887] [ENSMUST00000203636] [ENSMUST00000204682]
AlphaFold Q9JKL1
Predicted Effect probably benign
Transcript: ENSMUST00000050887
AA Change: T4A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059034
Gene: ENSMUSG00000049409
AA Change: T4A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203636
AA Change: T4A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145476
Gene: ENSMUSG00000049409
AA Change: T4A

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204682
AA Change: T4A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144999
Gene: ENSMUSG00000049409
AA Change: T4A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein-coupled receptor family. The encoded protein binds to prokineticins (1 and 2), leading to the activation of MAPK and STAT signaling pathways. Prokineticins are protein ligands involved in angiogenesis and inflammation. The encoded protein is expressed in peripheral tissues such as those comprising the circulatory system, lungs, reproductive system, endocrine system and the gastrointestinal system. The protein may be involved in signaling in human fetal ovary during initiation of primordial follicle formation. Sequence variants in this gene may be associated with recurrent miscarriage. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal nociceptions and hypoalgesia. Mice homozygous for another null allele exhibit decreased capillary density in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Prokr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Prokr1 APN 6 87588611 missense probably damaging 1.00
IGL00838:Prokr1 APN 6 87588693 missense possibly damaging 0.94
IGL01083:Prokr1 APN 6 87588784 missense probably benign 0.41
IGL02677:Prokr1 APN 6 87588368 splice site probably benign
IGL03344:Prokr1 APN 6 87588500 missense possibly damaging 0.95
R1953:Prokr1 UTSW 6 87588593 missense probably benign 0.18
R2065:Prokr1 UTSW 6 87588713 missense probably damaging 0.98
R3161:Prokr1 UTSW 6 87588431 missense probably damaging 1.00
R4777:Prokr1 UTSW 6 87588860 start codon destroyed probably null 0.98
R4828:Prokr1 UTSW 6 87581242 missense probably benign 0.07
R4890:Prokr1 UTSW 6 87588696 missense probably benign 0.00
R4943:Prokr1 UTSW 6 87581824 missense possibly damaging 0.90
R6134:Prokr1 UTSW 6 87588855 missense possibly damaging 0.54
R6329:Prokr1 UTSW 6 87581792 missense possibly damaging 0.94
R6794:Prokr1 UTSW 6 87588693 missense possibly damaging 0.94
R6922:Prokr1 UTSW 6 87588473 missense probably damaging 1.00
R8428:Prokr1 UTSW 6 87588774 missense probably benign
R8478:Prokr1 UTSW 6 87581348 missense probably benign 0.01
R9369:Prokr1 UTSW 6 87581425 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGGCAGCAAAGAAAGTCCG -3'
(R):5'- AATGGGTCTGCATAGGTTTCAG -3'

Sequencing Primer
(F):5'- AGTCCGAGAATTGGTCACATC -3'
(R):5'- CCTCCAACATGTAACCAATTGTGTG -3'
Posted On 2017-10-10