Incidental Mutation 'R6183:Vmn1r54'
ID 487621
Institutional Source Beutler Lab
Gene Symbol Vmn1r54
Ensembl Gene ENSMUSG00000047203
Gene Name vomeronasal 1 receptor 54
Synonyms V1ra9, VN7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 90246300-90271213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90269290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 62 (M62K)
Ref Sequence ENSEMBL: ENSMUSP00000154354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058039] [ENSMUST00000226921]
AlphaFold Q9EPB8
Predicted Effect possibly damaging
Transcript: ENSMUST00000058039
AA Change: M62K

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063052
Gene: ENSMUSG00000047203
AA Change: M62K

DomainStartEndE-ValueType
Pfam:TAS2R 11 307 1.2e-11 PFAM
Pfam:V1R 38 301 5.5e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226921
AA Change: M62K

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Vmn1r54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Vmn1r54 APN 6 90269460 missense probably damaging 1.00
IGL02421:Vmn1r54 APN 6 90269151 missense probably benign 0.01
IGL02535:Vmn1r54 APN 6 90269278 missense possibly damaging 0.78
IGL03083:Vmn1r54 APN 6 90269872 missense possibly damaging 0.82
R0646:Vmn1r54 UTSW 6 90269653 missense probably benign 0.00
R2047:Vmn1r54 UTSW 6 90269988 missense probably damaging 1.00
R4409:Vmn1r54 UTSW 6 90269882 nonsense probably null
R4467:Vmn1r54 UTSW 6 90269271 missense probably damaging 1.00
R4812:Vmn1r54 UTSW 6 90269325 missense probably benign 0.22
R5042:Vmn1r54 UTSW 6 90269440 missense possibly damaging 0.53
R5555:Vmn1r54 UTSW 6 90269365 missense probably benign 0.02
R6393:Vmn1r54 UTSW 6 90269322 missense probably benign 0.45
R7216:Vmn1r54 UTSW 6 90269665 missense probably damaging 1.00
R7480:Vmn1r54 UTSW 6 90269178 missense possibly damaging 0.58
R8413:Vmn1r54 UTSW 6 90269431 missense probably damaging 1.00
R8995:Vmn1r54 UTSW 6 90269686 missense probably benign 0.22
R9055:Vmn1r54 UTSW 6 90269118 missense probably benign 0.24
R9383:Vmn1r54 UTSW 6 90270027 missense probably benign 0.03
R9406:Vmn1r54 UTSW 6 90269110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTGTCCCATAACACCGAG -3'
(R):5'- TTGCAAGGGGACTGCTAATG -3'

Sequencing Primer
(F):5'- TGTCCCATAACACCGAGATAAG -3'
(R):5'- CGCTTGAACTTTTCTAAGCAGGAG -3'
Posted On 2017-10-10