Mutagenetix > Incidental Mutations

Incidental Mutation 'R6183:Vmn2r66'

487624

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r66

Ensembl Gene

ENSMUSG00000094950

Gene Name

vomeronasal 2, receptor 66

Synonyms

F830104D24Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84994645-85012020 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84995558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 548 (D548G)

Ref Sequence

ENSEMBL: ENSMUSP00000122645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124773]

AlphaFold

A0A3B2W842

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124773
AA Change: D548G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: D548G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	5e-31	PFAM
Pfam:NCD3G	507	559	6e-21	PFAM
Pfam:7tm_3	589	827	3.8e-52	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Vmn2r66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Vmn2r66	APN	7	85007091	missense	probably benign
IGL01562:Vmn2r66	APN	7	85007287	missense	probably benign	0.03
IGL01689:Vmn2r66	APN	7	85007825	missense	probably damaging	1.00
IGL02237:Vmn2r66	APN	7	84994700	missense	probably benign
IGL02415:Vmn2r66	APN	7	85006812	missense	probably damaging	0.97
IGL02439:Vmn2r66	APN	7	85005247	splice site	probably benign
IGL02545:Vmn2r66	APN	7	85006590	missense	possibly damaging	0.50
IGL02708:Vmn2r66	APN	7	85006588	missense	probably benign	0.00
IGL02794:Vmn2r66	APN	7	84995415	missense	probably benign	0.00
IGL02885:Vmn2r66	APN	7	84995515	missense	probably benign	0.00
IGL02975:Vmn2r66	APN	7	85006974	missense	probably damaging	0.98
IGL03027:Vmn2r66	APN	7	84995569	splice site	probably benign
IGL03081:Vmn2r66	APN	7	85007930	missense	probably benign
PIT4131001:Vmn2r66	UTSW	7	84995093	missense	probably damaging	1.00
R0098:Vmn2r66	UTSW	7	85005757	missense	probably damaging	1.00
R0504:Vmn2r66	UTSW	7	85006815	missense	probably damaging	0.99
R0557:Vmn2r66	UTSW	7	84994764	missense	probably damaging	1.00
R0617:Vmn2r66	UTSW	7	84995276	missense	probably benign	0.02
R0883:Vmn2r66	UTSW	7	85007862	missense	probably benign
R1159:Vmn2r66	UTSW	7	84995405	missense	probably benign	0.44
R1168:Vmn2r66	UTSW	7	85006854	missense	possibly damaging	0.46
R1172:Vmn2r66	UTSW	7	85005591	missense	probably benign	0.04
R1175:Vmn2r66	UTSW	7	85005591	missense	probably benign	0.04
R1538:Vmn2r66	UTSW	7	84994958	missense	possibly damaging	0.84
R1658:Vmn2r66	UTSW	7	85007747	missense	probably benign	0.07
R1937:Vmn2r66	UTSW	7	84995136	missense	probably damaging	0.99
R1989:Vmn2r66	UTSW	7	85011993	missense	probably benign	0.01
R2698:Vmn2r66	UTSW	7	84995399	missense	probably damaging	1.00
R2890:Vmn2r66	UTSW	7	85011819	splice site	probably null
R3686:Vmn2r66	UTSW	7	84995189	missense	probably damaging	0.96
R4152:Vmn2r66	UTSW	7	85005592	missense	probably benign	0.08
R4500:Vmn2r66	UTSW	7	85007954	missense	probably damaging	1.00
R4618:Vmn2r66	UTSW	7	84995088	missense	possibly damaging	0.62
R4656:Vmn2r66	UTSW	7	85011996	missense	possibly damaging	0.87
R4668:Vmn2r66	UTSW	7	84994697	missense	probably damaging	1.00
R4942:Vmn2r66	UTSW	7	85007772	missense	probably damaging	1.00
R5163:Vmn2r66	UTSW	7	85006809	missense	probably benign	0.01
R5223:Vmn2r66	UTSW	7	85007885	missense	probably benign
R5377:Vmn2r66	UTSW	7	85006818	missense	probably damaging	0.99
R5512:Vmn2r66	UTSW	7	85007941	missense	probably damaging	1.00
R5611:Vmn2r66	UTSW	7	85005743	nonsense	probably null
R5749:Vmn2r66	UTSW	7	85006771	nonsense	probably null
R6131:Vmn2r66	UTSW	7	84995016	missense	probably damaging	1.00
R6509:Vmn2r66	UTSW	7	85006846	missense	probably benign	0.12
R6930:Vmn2r66	UTSW	7	85012008	missense	possibly damaging	0.80
R6992:Vmn2r66	UTSW	7	85005228	missense	possibly damaging	0.90
R7015:Vmn2r66	UTSW	7	84995558	missense	possibly damaging	0.81
R7302:Vmn2r66	UTSW	7	85005215	missense	probably benign	0.00
R7516:Vmn2r66	UTSW	7	85011968	missense	possibly damaging	0.51
R7763:Vmn2r66	UTSW	7	85005701	missense	probably benign	0.01
R7814:Vmn2r66	UTSW	7	85007264	missense	probably benign	0.02
R8077:Vmn2r66	UTSW	7	85006885	missense	probably benign
R8307:Vmn2r66	UTSW	7	85007062	missense	probably benign
R8315:Vmn2r66	UTSW	7	84994724	missense	possibly damaging	0.90
R8490:Vmn2r66	UTSW	7	85005586	critical splice donor site	probably null
R8511:Vmn2r66	UTSW	7	85006818	missense	probably damaging	0.99
R8781:Vmn2r66	UTSW	7	84995147	nonsense	probably null
R8812:Vmn2r66	UTSW	7	85005685	missense	probably damaging	0.99
R9203:Vmn2r66	UTSW	7	85005742	missense	probably benign	0.01
R9277:Vmn2r66	UTSW	7	85011956	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTGTTTCAGGAAGACACAGATTAC -3'
(R):5'- CTTCTATTATCATCTGTTGGACTGG -3'

Sequencing Primer
(F):5'- TTTCAGGAAGACACAGATTACAACAG -3'
(R):5'- ATTATCATCTGTTGGACTGGATTGTG -3'

Posted On

2017-10-10