Incidental Mutation 'R6183:Vmn2r66'
ID 487624
Institutional Source Beutler Lab
Gene Symbol Vmn2r66
Ensembl Gene ENSMUSG00000094950
Gene Name vomeronasal 2, receptor 66
Synonyms F830104D24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 84994645-85012020 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84995558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 548 (D548G)
Ref Sequence ENSEMBL: ENSMUSP00000122645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124773]
AlphaFold A0A3B2W842
Predicted Effect possibly damaging
Transcript: ENSMUST00000124773
AA Change: D548G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: D548G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 5e-31 PFAM
Pfam:NCD3G 507 559 6e-21 PFAM
Pfam:7tm_3 589 827 3.8e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Vmn2r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Vmn2r66 APN 7 85007091 missense probably benign
IGL01562:Vmn2r66 APN 7 85007287 missense probably benign 0.03
IGL01689:Vmn2r66 APN 7 85007825 missense probably damaging 1.00
IGL02237:Vmn2r66 APN 7 84994700 missense probably benign
IGL02415:Vmn2r66 APN 7 85006812 missense probably damaging 0.97
IGL02439:Vmn2r66 APN 7 85005247 splice site probably benign
IGL02545:Vmn2r66 APN 7 85006590 missense possibly damaging 0.50
IGL02708:Vmn2r66 APN 7 85006588 missense probably benign 0.00
IGL02794:Vmn2r66 APN 7 84995415 missense probably benign 0.00
IGL02885:Vmn2r66 APN 7 84995515 missense probably benign 0.00
IGL02975:Vmn2r66 APN 7 85006974 missense probably damaging 0.98
IGL03027:Vmn2r66 APN 7 84995569 splice site probably benign
IGL03081:Vmn2r66 APN 7 85007930 missense probably benign
PIT4131001:Vmn2r66 UTSW 7 84995093 missense probably damaging 1.00
R0098:Vmn2r66 UTSW 7 85005757 missense probably damaging 1.00
R0504:Vmn2r66 UTSW 7 85006815 missense probably damaging 0.99
R0557:Vmn2r66 UTSW 7 84994764 missense probably damaging 1.00
R0617:Vmn2r66 UTSW 7 84995276 missense probably benign 0.02
R0883:Vmn2r66 UTSW 7 85007862 missense probably benign
R1159:Vmn2r66 UTSW 7 84995405 missense probably benign 0.44
R1168:Vmn2r66 UTSW 7 85006854 missense possibly damaging 0.46
R1172:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1175:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1538:Vmn2r66 UTSW 7 84994958 missense possibly damaging 0.84
R1658:Vmn2r66 UTSW 7 85007747 missense probably benign 0.07
R1937:Vmn2r66 UTSW 7 84995136 missense probably damaging 0.99
R1989:Vmn2r66 UTSW 7 85011993 missense probably benign 0.01
R2698:Vmn2r66 UTSW 7 84995399 missense probably damaging 1.00
R2890:Vmn2r66 UTSW 7 85011819 splice site probably null
R3686:Vmn2r66 UTSW 7 84995189 missense probably damaging 0.96
R4152:Vmn2r66 UTSW 7 85005592 missense probably benign 0.08
R4500:Vmn2r66 UTSW 7 85007954 missense probably damaging 1.00
R4618:Vmn2r66 UTSW 7 84995088 missense possibly damaging 0.62
R4656:Vmn2r66 UTSW 7 85011996 missense possibly damaging 0.87
R4668:Vmn2r66 UTSW 7 84994697 missense probably damaging 1.00
R4942:Vmn2r66 UTSW 7 85007772 missense probably damaging 1.00
R5163:Vmn2r66 UTSW 7 85006809 missense probably benign 0.01
R5223:Vmn2r66 UTSW 7 85007885 missense probably benign
R5377:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R5512:Vmn2r66 UTSW 7 85007941 missense probably damaging 1.00
R5611:Vmn2r66 UTSW 7 85005743 nonsense probably null
R5749:Vmn2r66 UTSW 7 85006771 nonsense probably null
R6131:Vmn2r66 UTSW 7 84995016 missense probably damaging 1.00
R6509:Vmn2r66 UTSW 7 85006846 missense probably benign 0.12
R6930:Vmn2r66 UTSW 7 85012008 missense possibly damaging 0.80
R6992:Vmn2r66 UTSW 7 85005228 missense possibly damaging 0.90
R7015:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R7302:Vmn2r66 UTSW 7 85005215 missense probably benign 0.00
R7516:Vmn2r66 UTSW 7 85011968 missense possibly damaging 0.51
R7763:Vmn2r66 UTSW 7 85005701 missense probably benign 0.01
R7814:Vmn2r66 UTSW 7 85007264 missense probably benign 0.02
R8077:Vmn2r66 UTSW 7 85006885 missense probably benign
R8307:Vmn2r66 UTSW 7 85007062 missense probably benign
R8315:Vmn2r66 UTSW 7 84994724 missense possibly damaging 0.90
R8490:Vmn2r66 UTSW 7 85005586 critical splice donor site probably null
R8511:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R8781:Vmn2r66 UTSW 7 84995147 nonsense probably null
R8812:Vmn2r66 UTSW 7 85005685 missense probably damaging 0.99
R9203:Vmn2r66 UTSW 7 85005742 missense probably benign 0.01
R9277:Vmn2r66 UTSW 7 85011956 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGTTTCAGGAAGACACAGATTAC -3'
(R):5'- CTTCTATTATCATCTGTTGGACTGG -3'

Sequencing Primer
(F):5'- TTTCAGGAAGACACAGATTACAACAG -3'
(R):5'- ATTATCATCTGTTGGACTGGATTGTG -3'
Posted On 2017-10-10