Incidental Mutation 'R6183:5830411N06Rik'
ID487625
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene NameRIKEN cDNA 5830411N06 gene
SynonymsScart2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6183 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140247284-140300736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140296034 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 404 (T404A)
Ref Sequence ENSEMBL: ENSMUSP00000091520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059882
SMART Domains Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093984
AA Change: T404A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: T404A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164583
AA Change: T520A

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: T520A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211749
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCCGACTGGTCAATGGCAG -3'
(R):5'- GACCTGACAGGGAGAAACTC -3'

Sequencing Primer
(F):5'- ACTTAGCAGATGCCACTG -3'
(R):5'- GAGGACCATCGCTCCGAAC -3'
Posted On2017-10-10