Incidental Mutation 'R6183:Tnfrsf26'
ID487627
Institutional Source Beutler Lab
Gene Symbol Tnfrsf26
Ensembl Gene ENSMUSG00000045362
Gene Nametumor necrosis factor receptor superfamily, member 26
SynonymsTnfrh3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6183 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143607659-143628722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143611757 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 47 (L47P)
Ref Sequence ENSEMBL: ENSMUSP00000146662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055723] [ENSMUST00000208124]
Predicted Effect probably benign
Transcript: ENSMUST00000055723
AA Change: L185P

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054938
Gene: ENSMUSG00000045362
AA Change: L185P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TNFR 27 61 1.95e0 SMART
TNFR 64 103 6.89e-8 SMART
TNFR 105 143 1.1e-6 SMART
transmembrane domain 163 185 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208124
AA Change: L47P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Tnfrsf26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03053:Tnfrsf26 APN 7 143614860 missense possibly damaging 0.83
R1120:Tnfrsf26 UTSW 7 143617914 missense probably damaging 1.00
R1465:Tnfrsf26 UTSW 7 143617931 missense probably damaging 1.00
R1465:Tnfrsf26 UTSW 7 143617931 missense probably damaging 1.00
R1957:Tnfrsf26 UTSW 7 143617923 missense probably damaging 1.00
R2132:Tnfrsf26 UTSW 7 143617840 critical splice donor site probably null
R6913:Tnfrsf26 UTSW 7 143618389 nonsense probably null
R7414:Tnfrsf26 UTSW 7 143614905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCAGTGCCAAGGGATC -3'
(R):5'- AGCAGGAACTTCTGTGGTCTG -3'

Sequencing Primer
(F):5'- GGATCTCACTTTGTAGACCAGGC -3'
(R):5'- GTCTGTTACTCTAATGAAGTCTGC -3'
Posted On2017-10-10