Mutagenetix > Incidental Mutation

Incidental Mutation 'R6183:Ces1g'

487629

Institutional Source

Beutler Lab

Gene Symbol

Ces1g

Ensembl Gene

ENSMUSG00000057074

Gene Name

carboxylesterase 1G

Synonyms

Ses-1, Ces1, Ces-1

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

93302369-93337308 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 93331239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 145 (V145M)

Ref Sequence

ENSEMBL: ENSMUSP00000037555 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044602]

AlphaFold

Q8VCC2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044602
AA Change: V145M

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000037555
Gene: ENSMUSG00000057074
AA Change: V145M

Domain	Start	End	E-Value	Type
Pfam:COesterase	1	545	3.6e-168	PFAM
Pfam:Abhydrolase_3	136	295	5.7e-11	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. The expression and activity of this gene is age-related but independent of growth hormone level. This gene is clustered with Ces7 and Ces3 on chromosome 8. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Ces1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Ces1g	APN	8	93302987	missense	possibly damaging	0.61
IGL00971:Ces1g	APN	8	93303032	missense	probably damaging	1.00
IGL01583:Ces1g	APN	8	93306959	missense	probably damaging	1.00
IGL02993:Ces1g	APN	8	93317079	missense	probably benign	0.00
IGL03386:Ces1g	APN	8	93325812	missense	probably benign	0.00
R0359:Ces1g	UTSW	8	93328535	splice site	probably benign
R0373:Ces1g	UTSW	8	93331193	missense	probably benign	0.06
R0499:Ces1g	UTSW	8	93333689	missense	probably benign	0.01
R0689:Ces1g	UTSW	8	93328407	missense	probably damaging	1.00
R1756:Ces1g	UTSW	8	93306954	missense	probably benign	0.03
R3052:Ces1g	UTSW	8	93335048	missense	possibly damaging	0.50
R3150:Ces1g	UTSW	8	93325816	missense	probably benign	0.45
R3899:Ces1g	UTSW	8	93303050	missense	probably damaging	1.00
R3966:Ces1g	UTSW	8	93328511	missense	possibly damaging	0.50
R4134:Ces1g	UTSW	8	93319872	missense	probably benign	0.00
R4198:Ces1g	UTSW	8	93305868	missense	probably benign	0.11
R4332:Ces1g	UTSW	8	93319818	missense	probably benign	0.01
R4719:Ces1g	UTSW	8	93317090	missense	possibly damaging	0.59
R4841:Ces1g	UTSW	8	93333695	missense	probably benign	0.01
R4842:Ces1g	UTSW	8	93333695	missense	probably benign	0.01
R4843:Ces1g	UTSW	8	93331265	missense	probably damaging	1.00
R5344:Ces1g	UTSW	8	93337193	start gained	probably benign
R5405:Ces1g	UTSW	8	93305868	missense	probably benign	0.29
R5425:Ces1g	UTSW	8	93325800	missense	probably benign	0.20
R5884:Ces1g	UTSW	8	93306930	missense	probably benign	0.24
R6022:Ces1g	UTSW	8	93328457	missense	probably damaging	1.00
R6197:Ces1g	UTSW	8	93337136	missense	probably benign	0.01
R6307:Ces1g	UTSW	8	93331192	missense	possibly damaging	0.60
R6688:Ces1g	UTSW	8	93306972	missense	possibly damaging	0.92
R6863:Ces1g	UTSW	8	93317019	missense	possibly damaging	0.92
R7097:Ces1g	UTSW	8	93317037	missense	possibly damaging	0.89
R7122:Ces1g	UTSW	8	93317037	missense	possibly damaging	0.89
R7180:Ces1g	UTSW	8	93302948	missense	probably benign	0.04
R7202:Ces1g	UTSW	8	93302967	missense	probably benign	0.01
R7361:Ces1g	UTSW	8	93333679	missense	not run
R7537:Ces1g	UTSW	8	93319827	missense	probably benign	0.01
R7621:Ces1g	UTSW	8	93328466	missense	probably damaging	1.00
R8200:Ces1g	UTSW	8	93328457	missense	probably damaging	1.00
R8895:Ces1g	UTSW	8	93319884	missense	possibly damaging	0.83
R9248:Ces1g	UTSW	8	93333691	missense	possibly damaging	0.62
R9290:Ces1g	UTSW	8	93302917	missense	probably benign	0.07
R9324:Ces1g	UTSW	8	93328490	missense	probably damaging	1.00
R9361:Ces1g	UTSW	8	93335018	critical splice donor site	probably null
R9565:Ces1g	UTSW	8	93335164	missense	probably benign	0.06
R9615:Ces1g	UTSW	8	93335179	missense	probably damaging	1.00
Z1176:Ces1g	UTSW	8	93325811	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTCCTGGACTTTTAACATCTGAAACC -3'
(R):5'- GCCTGTTACAGCCTTTCAGG -3'

Sequencing Primer
(F):5'- GGACTTTTAACATCTGAAACCTAAGC -3'
(R):5'- GTTACAGCCTTTCAGGACACTGG -3'

Posted On

2017-10-10