Incidental Mutation 'R6183:Ces1g'
ID 487629
Institutional Source Beutler Lab
Gene Symbol Ces1g
Ensembl Gene ENSMUSG00000057074
Gene Name carboxylesterase 1G
Synonyms Ses-1, Ces1, Ces-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 93302369-93337308 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 93331239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 145 (V145M)
Ref Sequence ENSEMBL: ENSMUSP00000037555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044602]
AlphaFold Q8VCC2
Predicted Effect possibly damaging
Transcript: ENSMUST00000044602
AA Change: V145M

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037555
Gene: ENSMUSG00000057074
AA Change: V145M

DomainStartEndE-ValueType
Pfam:COesterase 1 545 3.6e-168 PFAM
Pfam:Abhydrolase_3 136 295 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. The expression and activity of this gene is age-related but independent of growth hormone level. This gene is clustered with Ces7 and Ces3 on chromosome 8. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Ces1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ces1g APN 8 93302987 missense possibly damaging 0.61
IGL00971:Ces1g APN 8 93303032 missense probably damaging 1.00
IGL01583:Ces1g APN 8 93306959 missense probably damaging 1.00
IGL02993:Ces1g APN 8 93317079 missense probably benign 0.00
IGL03386:Ces1g APN 8 93325812 missense probably benign 0.00
R0359:Ces1g UTSW 8 93328535 splice site probably benign
R0373:Ces1g UTSW 8 93331193 missense probably benign 0.06
R0499:Ces1g UTSW 8 93333689 missense probably benign 0.01
R0689:Ces1g UTSW 8 93328407 missense probably damaging 1.00
R1756:Ces1g UTSW 8 93306954 missense probably benign 0.03
R3052:Ces1g UTSW 8 93335048 missense possibly damaging 0.50
R3150:Ces1g UTSW 8 93325816 missense probably benign 0.45
R3899:Ces1g UTSW 8 93303050 missense probably damaging 1.00
R3966:Ces1g UTSW 8 93328511 missense possibly damaging 0.50
R4134:Ces1g UTSW 8 93319872 missense probably benign 0.00
R4198:Ces1g UTSW 8 93305868 missense probably benign 0.11
R4332:Ces1g UTSW 8 93319818 missense probably benign 0.01
R4719:Ces1g UTSW 8 93317090 missense possibly damaging 0.59
R4841:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4842:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4843:Ces1g UTSW 8 93331265 missense probably damaging 1.00
R5344:Ces1g UTSW 8 93337193 start gained probably benign
R5405:Ces1g UTSW 8 93305868 missense probably benign 0.29
R5425:Ces1g UTSW 8 93325800 missense probably benign 0.20
R5884:Ces1g UTSW 8 93306930 missense probably benign 0.24
R6022:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R6197:Ces1g UTSW 8 93337136 missense probably benign 0.01
R6307:Ces1g UTSW 8 93331192 missense possibly damaging 0.60
R6688:Ces1g UTSW 8 93306972 missense possibly damaging 0.92
R6863:Ces1g UTSW 8 93317019 missense possibly damaging 0.92
R7097:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7122:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7180:Ces1g UTSW 8 93302948 missense probably benign 0.04
R7202:Ces1g UTSW 8 93302967 missense probably benign 0.01
R7361:Ces1g UTSW 8 93333679 missense not run
R7537:Ces1g UTSW 8 93319827 missense probably benign 0.01
R7621:Ces1g UTSW 8 93328466 missense probably damaging 1.00
R8200:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R8895:Ces1g UTSW 8 93319884 missense possibly damaging 0.83
R9248:Ces1g UTSW 8 93333691 missense possibly damaging 0.62
R9290:Ces1g UTSW 8 93302917 missense probably benign 0.07
R9324:Ces1g UTSW 8 93328490 missense probably damaging 1.00
R9361:Ces1g UTSW 8 93335018 critical splice donor site probably null
Z1176:Ces1g UTSW 8 93325811 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCCTGGACTTTTAACATCTGAAACC -3'
(R):5'- GCCTGTTACAGCCTTTCAGG -3'

Sequencing Primer
(F):5'- GGACTTTTAACATCTGAAACCTAAGC -3'
(R):5'- GTTACAGCCTTTCAGGACACTGG -3'
Posted On 2017-10-10