Mutagenetix > Incidental Mutation

Incidental Mutation 'R6183:Ephb1'

487630

Institutional Source

Beutler Lab

Gene Symbol

Ephb1

Ensembl Gene

ENSMUSG00000032537

Gene Name

Eph receptor B1

Synonyms

Cek6, Net, C130099E04Rik, Hek6, Elk, Elkh

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101922128-102354693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102195325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 85 (I85N)

Ref Sequence

ENSEMBL: ENSMUSP00000139470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169] [ENSMUST00000149800]

AlphaFold

Q8CBF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000035129
AA Change: I85N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: I85N

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
EPH_lbd	19	196	1.69e-129	SMART
FN3	323	416	2.44e-5	SMART
FN3	434	515	2.26e-9	SMART
Pfam:EphA2_TM	542	616	3e-24	PFAM
TyrKc	619	878	6.45e-141	SMART
SAM	908	975	1.22e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000085169
AA Change: I85N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537
AA Change: I85N

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
EPH_lbd	19	196	1.69e-129	SMART
FN3	323	416	2.44e-5	SMART
FN3	434	515	2.26e-9	SMART
transmembrane domain	541	563	N/A	INTRINSIC
TyrKc	585	837	2.35e-134	SMART
SAM	867	934	1.22e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000149800
AA Change: I85N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139470
Gene: ENSMUSG00000032537
AA Change: I85N

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
EPH_lbd	19	196	1.69e-129	SMART
FN3	323	416	2.44e-5	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Ephb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01671:Ephb1	APN	9	101996787	missense	probably damaging	1.00
IGL01910:Ephb1	APN	9	102001857	missense	probably benign	0.00
IGL02006:Ephb1	APN	9	102194772	critical splice donor site	probably null
IGL02660:Ephb1	APN	9	102041092	missense	possibly damaging	0.94
IGL02685:Ephb1	APN	9	102041103	nonsense	probably null
IGL02802:Ephb1	UTSW	9	102010019	missense	possibly damaging	0.87
R0098:Ephb1	UTSW	9	102041140	missense	probably damaging	0.98
R0098:Ephb1	UTSW	9	102041140	missense	probably damaging	0.98
R0180:Ephb1	UTSW	9	101927504	missense	probably damaging	0.99
R0488:Ephb1	UTSW	9	101964008	missense	probably damaging	1.00
R0511:Ephb1	UTSW	9	101995980	splice site	probably benign
R0601:Ephb1	UTSW	9	102195130	missense	probably damaging	1.00
R1622:Ephb1	UTSW	9	102001711	missense	probably benign	0.00
R1643:Ephb1	UTSW	9	101996825	missense	probably damaging	0.99
R1645:Ephb1	UTSW	9	101927559	missense	probably damaging	1.00
R1914:Ephb1	UTSW	9	101929378	missense	probably damaging	1.00
R1964:Ephb1	UTSW	9	101971123	missense	possibly damaging	0.93
R2245:Ephb1	UTSW	9	101996774	splice site	probably benign
R2247:Ephb1	UTSW	9	101996811	missense	probably damaging	0.98
R2412:Ephb1	UTSW	9	102001816	missense	possibly damaging	0.85
R3716:Ephb1	UTSW	9	102194800	missense	probably damaging	1.00
R3756:Ephb1	UTSW	9	102041039	missense	probably benign	0.01
R3797:Ephb1	UTSW	9	101971267	missense	probably damaging	1.00
R3907:Ephb1	UTSW	9	102001726	missense	probably benign	0.00
R4981:Ephb1	UTSW	9	102040960	missense	probably benign
R5112:Ephb1	UTSW	9	101971179	missense	probably damaging	1.00
R5507:Ephb1	UTSW	9	101936116	missense	probably damaging	1.00
R5745:Ephb1	UTSW	9	102195434	missense	probably benign	0.25
R6082:Ephb1	UTSW	9	101971104	missense	probably damaging	1.00
R6228:Ephb1	UTSW	9	101923584	missense	probably damaging	1.00
R6572:Ephb1	UTSW	9	102066898	missense	probably benign
R6596:Ephb1	UTSW	9	102194802	nonsense	probably null
R6813:Ephb1	UTSW	9	102010048	missense	possibly damaging	0.87
R6876:Ephb1	UTSW	9	101984120	missense	probably damaging	1.00
R6922:Ephb1	UTSW	9	101929264	splice site	probably null
R6950:Ephb1	UTSW	9	102194909	missense	probably benign	0.03
R7144:Ephb1	UTSW	9	101964077	missense	probably damaging	1.00
R7146:Ephb1	UTSW	9	101963958	missense	probably damaging	1.00
R7328:Ephb1	UTSW	9	102195239	missense	probably damaging	1.00
R7644:Ephb1	UTSW	9	101936194	missense	probably damaging	1.00
R7737:Ephb1	UTSW	9	101984103	missense	probably damaging	1.00
R8109:Ephb1	UTSW	9	102041023	missense	probably damaging	1.00
R8161:Ephb1	UTSW	9	102194813	missense	probably damaging	1.00
R8486:Ephb1	UTSW	9	101963965	missense	probably benign	0.00
R8958:Ephb1	UTSW	9	102195415	missense	probably damaging	1.00
R9502:Ephb1	UTSW	9	102041287	missense	probably damaging	1.00
R9627:Ephb1	UTSW	9	102041269	missense	possibly damaging	0.94
R9715:Ephb1	UTSW	9	101971185	missense	probably damaging	1.00
X0064:Ephb1	UTSW	9	101971272	missense	probably damaging	1.00
Z1088:Ephb1	UTSW	9	101984145	missense	probably damaging	0.99
Z1176:Ephb1	UTSW	9	102223398	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCATCTGCAGCAATGGTG -3'
(R):5'- GCCACTGAGATTCCCTTCTGTG -3'

Sequencing Primer
(F):5'- ATCTGCAGCAATGGTGTCCAC -3'
(R):5'- GAGATTCCCTTCTGTGTTGACCATTG -3'

Posted On

2017-10-10