Incidental Mutation 'R6183:Qrich2'
ID487632
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6183 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 116458129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134182
SMART Domains Protein: ENSMUSP00000115947
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
Blast:MYSc 1 287 4e-80 BLAST
coiled coil region 336 351 N/A INTRINSIC
low complexity region 602 622 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208602
AA Change: H623L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R2178:Qrich2 UTSW 11 116443777 missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6211:Qrich2 UTSW 11 116453542 missense probably benign 0.41
R6375:Qrich2 UTSW 11 116458228 unclassified probably benign
R6452:Qrich2 UTSW 11 116455888 missense probably benign 0.01
R6870:Qrich2 UTSW 11 116455330 missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7753:Qrich2 UTSW 11 116457042 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7916:Qrich2 UTSW 11 116455765 missense probably benign 0.04
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- CACGTTGATCTACACTAGGCTG -3'
(R):5'- TTAGATCGGCGCAGTTCAGTG -3'

Sequencing Primer
(F):5'- TTGATCTACACTAGGCTGTACCCAAC -3'
(R):5'- CGCAGTTCAGTGCCTGTAG -3'
Posted On2017-10-10