Mutagenetix > Incidental Mutations

Incidental Mutation 'R6183:Rtn1'

487633

Institutional Source

Beutler Lab

Gene Symbol

Rtn1

Ensembl Gene

ENSMUSG00000021087

Gene Name

reticulon 1

Synonyms

Rtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72211752-72409054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72408491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 21 (W21R)

Ref Sequence

ENSEMBL: ENSMUSP00000077594 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078505]

AlphaFold

Q8K0T0

Predicted Effect

probably benign
Transcript: ENSMUST00000078505
AA Change: W21R

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087
AA Change: W21R

Domain	Start	End	E-Value	Type
low complexity region	135	152	N/A	INTRINSIC
low complexity region	217	226	N/A	INTRINSIC
low complexity region	327	341	N/A	INTRINSIC
low complexity region	438	448	N/A	INTRINSIC
low complexity region	473	480	N/A	INTRINSIC
low complexity region	574	586	N/A	INTRINSIC
Pfam:Reticulon	593	757	2.2e-46	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Rtn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Rtn1	APN	12	72408511	missense	probably benign	0.18
IGL01335:Rtn1	APN	12	72308350	missense	probably benign
IGL01394:Rtn1	APN	12	72308416	missense	probably benign	0.00
IGL01551:Rtn1	APN	12	72216935	missense	possibly damaging	0.63
IGL01865:Rtn1	APN	12	72219300	missense	probably damaging	1.00
IGL02585:Rtn1	APN	12	72308155	critical splice donor site	probably null
PIT4802001:Rtn1	UTSW	12	72304326	missense	probably benign	0.21
R0104:Rtn1	UTSW	12	72308845	missense	probably damaging	0.99
R0866:Rtn1	UTSW	12	72308382	nonsense	probably null
R1099:Rtn1	UTSW	12	72304467	splice site	probably null
R1438:Rtn1	UTSW	12	72304413	missense	probably damaging	0.98
R1610:Rtn1	UTSW	12	72219279	missense	possibly damaging	0.90
R1694:Rtn1	UTSW	12	72223524	missense	probably damaging	1.00
R1869:Rtn1	UTSW	12	72308168	missense	probably damaging	1.00
R1888:Rtn1	UTSW	12	72236533	intron	probably benign
R1889:Rtn1	UTSW	12	72304410	missense	possibly damaging	0.87
R1892:Rtn1	UTSW	12	72212563	missense	probably damaging	1.00
R2418:Rtn1	UTSW	12	72304278	missense	probably benign
R2760:Rtn1	UTSW	12	72408362	missense	probably benign	0.00
R2973:Rtn1	UTSW	12	72223389	missense	probably damaging	1.00
R4567:Rtn1	UTSW	12	72212487	utr 3 prime	probably benign
R4880:Rtn1	UTSW	12	72217458	missense	possibly damaging	0.88
R4945:Rtn1	UTSW	12	72217484	missense	probably damaging	1.00
R6493:Rtn1	UTSW	12	72308329	missense	probably damaging	0.99
R6547:Rtn1	UTSW	12	72308761	missense	possibly damaging	0.59
R6602:Rtn1	UTSW	12	72219318	missense	probably damaging	0.99
R7474:Rtn1	UTSW	12	72308390	missense	possibly damaging	0.87
R7615:Rtn1	UTSW	12	72304143	missense	probably damaging	1.00
R7697:Rtn1	UTSW	12	72408377	missense	probably benign	0.32
R7748:Rtn1	UTSW	12	72216926	missense	possibly damaging	0.53
R7754:Rtn1	UTSW	12	72308429	missense	probably damaging	0.96
R7834:Rtn1	UTSW	12	72304032	missense	probably damaging	0.99
R7970:Rtn1	UTSW	12	72308874	missense	probably benign	0.06
R8290:Rtn1	UTSW	12	72308419	missense	probably benign	0.07
R8311:Rtn1	UTSW	12	72304064	missense	probably damaging	1.00
R8440:Rtn1	UTSW	12	72223399	missense	probably damaging	1.00
R9393:Rtn1	UTSW	12	72216812	nonsense	probably null
Z1177:Rtn1	UTSW	12	72308864	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ACCTGTGGATGCAGTTTCCATG -3'
(R):5'- CGAGTTGCAGCAAAAGCAGC -3'

Sequencing Primer
(F):5'- ATGCAGTTTCCATGGCGAC -3'
(R):5'- AGACTCTGCAGCCTTCTGG -3'

Posted On

2017-10-10