Incidental Mutation 'R6183:Gm5458'
ID 487635
Institutional Source Beutler Lab
Gene Symbol Gm5458
Ensembl Gene ENSMUSG00000095024
Gene Name predicted gene 5458
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # R6183 (G1)
Quality Score 89.0077
Status Not validated
Chromosome 14
Chromosomal Location 19594139-19602581 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 19599644 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 171 (V171L)
Ref Sequence ENSEMBL: ENSMUSP00000093833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096121]
AlphaFold L7N219
Predicted Effect probably damaging
Transcript: ENSMUST00000096121
AA Change: V171L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093833
Gene: ENSMUSG00000095024
AA Change: V171L

DomainStartEndE-ValueType
Pfam:Takusan 46 129 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163800
AA Change: V171L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130345
Gene: ENSMUSG00000095024
AA Change: V171L

DomainStartEndE-ValueType
Pfam:Takusan 46 129 2.4e-32 PFAM
transmembrane domain 240 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Gm5458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Gm5458 APN 14 19599667 missense probably damaging 1.00
IGL01074:Gm5458 APN 14 19599692 missense probably damaging 0.99
IGL01116:Gm5458 APN 14 19599692 missense probably damaging 0.99
IGL03083:Gm5458 APN 14 19602383 splice site probably null
R7737:Gm5458 UTSW 14 19599737 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAGACATAGGTGAGTGCCTG -3'
(R):5'- AGACTCTTCTGGGACTGTCTGG -3'

Sequencing Primer
(F):5'- CCTGGAGAAGTTGGTGGAC -3'
(R):5'- ACTGTCTGGGGTTCAGGGC -3'
Posted On 2017-10-10