Incidental Mutation 'R6183:Olfr1507'
ID 487638
Institutional Source Beutler Lab
Gene Symbol Olfr1507
Ensembl Gene ENSMUSG00000059887
Gene Name olfactory receptor 1507
Synonyms MOR244-1, MOR28, GA_x6K02T2RJGY-491851-492792
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52488791-52495749 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52490731 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 78 (T78S)
Ref Sequence ENSEMBL: ENSMUSP00000146152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073571] [ENSMUST00000205963] [ENSMUST00000206062] [ENSMUST00000206069] [ENSMUST00000206931]
AlphaFold Q0VEP0
Predicted Effect probably benign
Transcript: ENSMUST00000073571
AA Change: T78S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073260
Gene: ENSMUSG00000059887
AA Change: T78S

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 305 3.6e-9 PFAM
Pfam:7tm_1 44 290 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205963
AA Change: T51S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000206062
AA Change: T78S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000206069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206087
AA Change: T78S
Predicted Effect probably benign
Transcript: ENSMUST00000206931
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Olfr1507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr1507 APN 14 52490748 missense probably damaging 1.00
IGL01367:Olfr1507 APN 14 52490167 missense probably benign 0.42
IGL01664:Olfr1507 APN 14 52490545 missense probably benign 0.01
IGL02890:Olfr1507 APN 14 52490911 missense probably benign
IGL03108:Olfr1507 APN 14 52490076 missense probably damaging 0.97
IGL03184:Olfr1507 APN 14 52490923 missense probably benign 0.20
R0563:Olfr1507 UTSW 14 52490257 nonsense probably null
R1080:Olfr1507 UTSW 14 52490585 nonsense probably null
R1558:Olfr1507 UTSW 14 52490146 missense probably benign 0.26
R1653:Olfr1507 UTSW 14 52490772 missense probably damaging 1.00
R1714:Olfr1507 UTSW 14 52490414 splice site probably null
R1720:Olfr1507 UTSW 14 52490594 nonsense probably null
R3430:Olfr1507 UTSW 14 52490425 missense possibly damaging 0.92
R4995:Olfr1507 UTSW 14 52490531 nonsense probably null
R5954:Olfr1507 UTSW 14 52490167 missense probably benign 0.42
R6518:Olfr1507 UTSW 14 52490620 missense probably damaging 1.00
R6651:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6652:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6653:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R7385:Olfr1507 UTSW 14 52490181 missense probably damaging 1.00
R7524:Olfr1507 UTSW 14 52490293 missense probably damaging 1.00
R8902:Olfr1507 UTSW 14 52490553 missense probably benign 0.02
R9165:Olfr1507 UTSW 14 52490373 missense possibly damaging 0.71
X0025:Olfr1507 UTSW 14 52490466 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAAAGGTTTACAAATGGCC -3'
(R):5'- TGGAAAAGGCTGTCCTCATC -3'

Sequencing Primer
(F):5'- GGTTTACAAATGGCCACATAGCGATC -3'
(R):5'- GGCTCACAGGTTTATCTACAAATCCG -3'
Posted On 2017-10-10