Mutagenetix > Incidental Mutation

Incidental Mutation 'R6183:Olfr1507'

487638

Institutional Source

Beutler Lab

Gene Symbol

Olfr1507

Ensembl Gene

ENSMUSG00000059887

Gene Name

olfactory receptor 1507

Synonyms

MOR244-1, MOR28, GA_x6K02T2RJGY-491851-492792

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52488791-52495749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52490731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 78 (T78S)

Ref Sequence

ENSEMBL: ENSMUSP00000146152 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073571] [ENSMUST00000205963] [ENSMUST00000206062] [ENSMUST00000206069] [ENSMUST00000206931]

AlphaFold

Q0VEP0

Predicted Effect

probably benign
Transcript: ENSMUST00000073571
AA Change: T78S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000073260
Gene: ENSMUSG00000059887
AA Change: T78S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	34	308	1.1e-47	PFAM
Pfam:7TM_GPCR_Srsx	38	305	3.6e-9	PFAM
Pfam:7tm_1	44	290	9.1e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205963
AA Change: T51S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000206062
AA Change: T78S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000206069

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206087
AA Change: T78S

Predicted Effect

probably benign
Transcript: ENSMUST00000206931

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Unc13a	A	T	8: 71,644,666	S1195T	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Olfr1507

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01336:Olfr1507	APN	14	52490748	missense	probably damaging	1.00
IGL01367:Olfr1507	APN	14	52490167	missense	probably benign	0.42
IGL01664:Olfr1507	APN	14	52490545	missense	probably benign	0.01
IGL02890:Olfr1507	APN	14	52490911	missense	probably benign
IGL03108:Olfr1507	APN	14	52490076	missense	probably damaging	0.97
IGL03184:Olfr1507	APN	14	52490923	missense	probably benign	0.20
R0563:Olfr1507	UTSW	14	52490257	nonsense	probably null
R1080:Olfr1507	UTSW	14	52490585	nonsense	probably null
R1558:Olfr1507	UTSW	14	52490146	missense	probably benign	0.26
R1653:Olfr1507	UTSW	14	52490772	missense	probably damaging	1.00
R1714:Olfr1507	UTSW	14	52490414	splice site	probably null
R1720:Olfr1507	UTSW	14	52490594	nonsense	probably null
R3430:Olfr1507	UTSW	14	52490425	missense	possibly damaging	0.92
R4995:Olfr1507	UTSW	14	52490531	nonsense	probably null
R5954:Olfr1507	UTSW	14	52490167	missense	probably benign	0.42
R6518:Olfr1507	UTSW	14	52490620	missense	probably damaging	1.00
R6651:Olfr1507	UTSW	14	52490793	missense	probably benign	0.07
R6652:Olfr1507	UTSW	14	52490793	missense	probably benign	0.07
R6653:Olfr1507	UTSW	14	52490793	missense	probably benign	0.07
R7385:Olfr1507	UTSW	14	52490181	missense	probably damaging	1.00
R7524:Olfr1507	UTSW	14	52490293	missense	probably damaging	1.00
R8902:Olfr1507	UTSW	14	52490553	missense	probably benign	0.02
R9165:Olfr1507	UTSW	14	52490373	missense	possibly damaging	0.71
R9763:Olfr1507	UTSW	14	52490850	missense	probably damaging	1.00
X0025:Olfr1507	UTSW	14	52490466	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTCAAAGGTTTACAAATGGCC -3'
(R):5'- TGGAAAAGGCTGTCCTCATC -3'

Sequencing Primer
(F):5'- GGTTTACAAATGGCCACATAGCGATC -3'
(R):5'- GGCTCACAGGTTTATCTACAAATCCG -3'

Posted On

2017-10-10