Incidental Mutation 'R6183:Ncald'
ID 487639
Institutional Source Beutler Lab
Gene Symbol Ncald
Ensembl Gene ENSMUSG00000051359
Gene Name neurocalcin delta
Synonyms D15Ertd412e, D030020D09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 37366175-37792570 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37397232 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 68 (V68D)
Ref Sequence ENSEMBL: ENSMUSP00000130126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090150] [ENSMUST00000116445] [ENSMUST00000119730] [ENSMUST00000120746] [ENSMUST00000148652] [ENSMUST00000150453] [ENSMUST00000153775] [ENSMUST00000168992]
AlphaFold Q91X97
Predicted Effect probably damaging
Transcript: ENSMUST00000090150
AA Change: V68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087611
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116445
AA Change: V68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112146
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119730
AA Change: V68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113858
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120746
AA Change: V68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112898
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132423
Predicted Effect probably damaging
Transcript: ENSMUST00000148652
AA Change: V68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121460
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
Pfam:EF-hand_5 149 163 1.2e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150453
AA Change: V68D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119726
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
Pfam:EF-hand_7 3 88 3.9e-8 PFAM
Pfam:EF-hand_8 39 88 8.2e-8 PFAM
Pfam:EF-hand_1 64 88 5e-8 PFAM
Pfam:EF-hand_6 64 88 1.6e-6 PFAM
Pfam:EF-hand_5 65 86 2.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153775
AA Change: V68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114576
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 174 1.4e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168992
AA Change: V68D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130126
Gene: ENSMUSG00000051359
AA Change: V68D

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuronal calcium sensor (NCS) family of calcium-binding proteins. The protein contains an N-terminal myristoylation signal and four EF-hand calcium binding loops. The protein is cytosolic at resting calcium levels; however, elevated intracellular calcium levels induce a conformational change that exposes the myristoyl group, resulting in protein association with membranes and partial co-localization with the perinuclear trans-golgi network. The protein is thought to be a regulator of G protein-coupled receptor signal transduction. Several alternatively spliced variants of this gene have been determined, all of which encode the same protein; additional variants may exist but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele could not be generated. Mice heterozygous for the targeted allele exhibit increased systemic arterial systolic blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Ncald
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Ncald APN 15 37372207 missense possibly damaging 0.78
IGL02373:Ncald APN 15 37372209 missense probably benign 0.05
R0507:Ncald UTSW 15 37397284 missense probably benign 0.03
R1168:Ncald UTSW 15 37397334 missense probably damaging 0.99
R1700:Ncald UTSW 15 37397343 missense probably benign 0.04
R1914:Ncald UTSW 15 37397080 missense probably benign 0.00
R1915:Ncald UTSW 15 37397080 missense probably benign 0.00
R2057:Ncald UTSW 15 37397179 missense possibly damaging 0.93
R3873:Ncald UTSW 15 37397253 missense probably damaging 1.00
R4612:Ncald UTSW 15 37397349 missense probably benign 0.04
R5071:Ncald UTSW 15 37397234 missense probably damaging 1.00
R5073:Ncald UTSW 15 37397234 missense probably damaging 1.00
R5074:Ncald UTSW 15 37397234 missense probably damaging 1.00
R7036:Ncald UTSW 15 37368878 missense probably benign 0.00
R7334:Ncald UTSW 15 37397280 missense probably damaging 0.99
R7764:Ncald UTSW 15 37397210 missense probably damaging 1.00
R8286:Ncald UTSW 15 37397261 nonsense probably null
R8983:Ncald UTSW 15 37397268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTCCTTACCTGTACAATC -3'
(R):5'- AATTCTTGTTGCCAGAATGGGG -3'

Sequencing Primer
(F):5'- GGGTCCTTACCTGTACAATCTCCAG -3'
(R):5'- AAGCTGCGCCCTGAAGTC -3'
Posted On 2017-10-10