Incidental Mutation 'R6183:Zc3h7a'
ID 487641
Institutional Source Beutler Lab
Gene Symbol Zc3h7a
Ensembl Gene ENSMUSG00000037965
Gene Name zinc finger CCCH type containing 7 A
Synonyms Zc3h7, A430104C18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 11136592-11176393 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11147370 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 633 (I633N)
Ref Sequence ENSEMBL: ENSMUSP00000119480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000128083] [ENSMUST00000138185] [ENSMUST00000140755]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037633
AA Change: I633N

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965
AA Change: I633N

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102303
Predicted Effect probably benign
Transcript: ENSMUST00000128083
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000138185
AA Change: I633N

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965
AA Change: I633N

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139391
Predicted Effect probably benign
Transcript: ENSMUST00000140755
SMART Domains Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 1e-7 PFAM
Blast:TPR 124 156 5e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140775
Predicted Effect unknown
Transcript: ENSMUST00000140898
AA Change: I49N
SMART Domains Protein: ENSMUSP00000118771
Gene: ENSMUSG00000037965
AA Change: I49N

DomainStartEndE-ValueType
Blast:ZnF_C3H1 45 71 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155343
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Other mutations in Zc3h7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Zc3h7a APN 16 11137338 missense probably damaging 0.98
IGL00908:Zc3h7a APN 16 11145242 missense probably damaging 0.99
IGL01087:Zc3h7a APN 16 11153182 missense probably benign 0.28
IGL01285:Zc3h7a APN 16 11139115 missense probably damaging 1.00
IGL01453:Zc3h7a APN 16 11149378 missense probably benign 0.00
IGL01639:Zc3h7a APN 16 11141708 missense possibly damaging 0.75
IGL01716:Zc3h7a APN 16 11145716 missense probably damaging 1.00
IGL02059:Zc3h7a APN 16 11160998 unclassified probably benign
IGL02170:Zc3h7a APN 16 11146395 missense probably benign
IGL02256:Zc3h7a APN 16 11147276 missense probably benign 0.04
IGL02904:Zc3h7a APN 16 11150666 missense probably damaging 1.00
IGL02941:Zc3h7a APN 16 11158594 critical splice acceptor site probably null
IGL03198:Zc3h7a APN 16 11162664 nonsense probably null
IGL03201:Zc3h7a APN 16 11156302 critical splice acceptor site probably null
IGL03302:Zc3h7a APN 16 11141710 missense probably damaging 1.00
agreement UTSW 16 11153161 missense probably benign 0.02
Clement UTSW 16 11164602 nonsense probably null
consensus UTSW 16 11161026 missense probably damaging 1.00
R0062:Zc3h7a UTSW 16 11139147 missense probably damaging 1.00
R0255:Zc3h7a UTSW 16 11140737 missense probably damaging 1.00
R0376:Zc3h7a UTSW 16 11156202 missense probably benign 0.00
R0545:Zc3h7a UTSW 16 11152333 unclassified probably benign
R0666:Zc3h7a UTSW 16 11156303 unclassified probably benign
R0831:Zc3h7a UTSW 16 11151880 missense probably damaging 0.99
R1127:Zc3h7a UTSW 16 11139075 missense probably damaging 1.00
R1296:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1472:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1499:Zc3h7a UTSW 16 11162656 missense probably damaging 1.00
R1747:Zc3h7a UTSW 16 11145253 missense possibly damaging 0.67
R1786:Zc3h7a UTSW 16 11150605 nonsense probably null
R1840:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1866:Zc3h7a UTSW 16 11147304 missense possibly damaging 0.81
R2055:Zc3h7a UTSW 16 11137476 missense probably benign 0.00
R2131:Zc3h7a UTSW 16 11150605 nonsense probably null
R2281:Zc3h7a UTSW 16 11158594 unclassified probably benign
R2399:Zc3h7a UTSW 16 11147401 missense probably damaging 1.00
R2979:Zc3h7a UTSW 16 11158973 missense probably damaging 1.00
R3915:Zc3h7a UTSW 16 11156210 missense possibly damaging 0.92
R4078:Zc3h7a UTSW 16 11151147 missense probably benign 0.05
R4095:Zc3h7a UTSW 16 11145235 missense probably damaging 1.00
R4208:Zc3h7a UTSW 16 11164644 missense possibly damaging 0.60
R4444:Zc3h7a UTSW 16 11150593 critical splice donor site probably null
R4739:Zc3h7a UTSW 16 11141709 missense probably damaging 1.00
R5059:Zc3h7a UTSW 16 11161121 frame shift probably null
R5545:Zc3h7a UTSW 16 11148451 missense possibly damaging 0.89
R5815:Zc3h7a UTSW 16 11156186 missense probably damaging 0.98
R5915:Zc3h7a UTSW 16 11164602 nonsense probably null
R5993:Zc3h7a UTSW 16 11150662 missense probably damaging 1.00
R6459:Zc3h7a UTSW 16 11153161 missense probably damaging 1.00
R6513:Zc3h7a UTSW 16 11158765 critical splice acceptor site probably null
R6700:Zc3h7a UTSW 16 11158967 missense possibly damaging 0.59
R6904:Zc3h7a UTSW 16 11145671 missense probably damaging 1.00
R6964:Zc3h7a UTSW 16 11149224 missense probably benign 0.00
R7354:Zc3h7a UTSW 16 11148514 missense probably damaging 1.00
R7667:Zc3h7a UTSW 16 11139026 nonsense probably null
R7742:Zc3h7a UTSW 16 11153161 missense probably benign 0.02
R7780:Zc3h7a UTSW 16 11149251 missense probably benign 0.26
R8228:Zc3h7a UTSW 16 11139090 missense probably damaging 1.00
R8302:Zc3h7a UTSW 16 11137385 missense probably damaging 1.00
R8309:Zc3h7a UTSW 16 11146553 intron probably benign
R8795:Zc3h7a UTSW 16 11147283 missense possibly damaging 0.65
R9060:Zc3h7a UTSW 16 11151183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTATCGAATGAGCTGGCTG -3'
(R):5'- CAGACTAGAACTTGACATTGTACG -3'

Sequencing Primer
(F):5'- AGCTGGCTGAGAAGTGTAATTC -3'
(R):5'- AGGTGCCTTGTCCACATT -3'
Posted On 2017-10-10