Incidental Mutation 'R6183:Spast'
ID 487645
Institutional Source Beutler Lab
Gene Symbol Spast
Ensembl Gene ENSMUSG00000024068
Gene Name spastin
Synonyms Spg4
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 74338987-74391115 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74373358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 438 (I438M)
Ref Sequence ENSEMBL: ENSMUSP00000024869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024869] [ENSMUST00000224711] [ENSMUST00000225549]
AlphaFold Q9QYY8
Predicted Effect probably damaging
Transcript: ENSMUST00000024869
AA Change: I438M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024869
Gene: ENSMUSG00000024068
AA Change: I438M

DomainStartEndE-ValueType
low complexity region 3 46 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 90 113 N/A INTRINSIC
MIT 114 192 4.33e-18 SMART
AAA 372 508 7.59e-17 SMART
low complexity region 513 520 N/A INTRINSIC
Pfam:Vps4_C 560 610 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224711
AA Change: I437M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000225549
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The encoded ATPase may be involved in the assembly or function of nuclear protein complexes. Two transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequences have not been determined. Mutations associated with this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene are sterile and display progressive axonopathy with focal axonal swellings and late onset gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Lvrn A G 18: 46,850,685 N165S probably benign Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Spast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Spast APN 17 74372339 splice site probably benign
R0671:Spast UTSW 17 74339451 splice site probably benign
R1170:Spast UTSW 17 74381968 critical splice acceptor site probably null
R1698:Spast UTSW 17 74356160 nonsense probably null
R2076:Spast UTSW 17 74352031 missense probably damaging 1.00
R4334:Spast UTSW 17 74352015 missense probably damaging 1.00
R4765:Spast UTSW 17 74369216 missense probably damaging 1.00
R5002:Spast UTSW 17 74369226 nonsense probably null
R5911:Spast UTSW 17 74387063 missense probably benign 0.00
R6073:Spast UTSW 17 74373305 missense probably damaging 1.00
R6450:Spast UTSW 17 74368840 missense probably benign 0.01
R6819:Spast UTSW 17 74367286 missense possibly damaging 0.47
R6821:Spast UTSW 17 74351962 missense probably benign 0.02
R7349:Spast UTSW 17 74373324 missense probably damaging 0.99
R7611:Spast UTSW 17 74369203 missense probably damaging 1.00
R7715:Spast UTSW 17 74368926 missense probably benign 0.01
R8348:Spast UTSW 17 74359298 missense probably benign 0.41
R8448:Spast UTSW 17 74359298 missense probably benign 0.41
R8698:Spast UTSW 17 74359346 missense probably benign 0.00
R8857:Spast UTSW 17 74368943 missense possibly damaging 0.77
R8898:Spast UTSW 17 74388278 missense probably damaging 1.00
R9269:Spast UTSW 17 74339074 nonsense probably null
R9472:Spast UTSW 17 74374148 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGTAGGATGTGAAATAGTTCTCAC -3'
(R):5'- CCTAAGCCCGTCATTTTAATATGCATC -3'

Sequencing Primer
(F):5'- CTCACTAAACTTCAGTTTGCAAAAGG -3'
(R):5'- GAGAGAACACTGCTTGCTTTTC -3'
Posted On 2017-10-10