Incidental Mutation 'R6183:Lvrn'
ID 487648
Institutional Source Beutler Lab
Gene Symbol Lvrn
Ensembl Gene ENSMUSG00000024481
Gene Name laeverin
Synonyms 4833403I15Rik, Aqpep
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock # R6183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 46850039-46905446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46850685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 165 (N165S)
Ref Sequence ENSEMBL: ENSMUSP00000025358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025358]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025358
AA Change: N165S

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025358
Gene: ENSMUSG00000024481
AA Change: N165S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Peptidase_M1 94 504 1.6e-110 PFAM
Pfam:ERAP1_C 645 968 2.5e-60 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,487,976 Y358H probably damaging Het
5830411N06Rik A G 7: 140,296,034 T404A possibly damaging Het
Abcb4 T A 5: 8,918,718 D352E probably benign Het
Adgrb3 T A 1: 25,094,370 I972L probably damaging Het
Alg3 T C 16: 20,610,641 Y33C probably benign Het
Atp1a3 C T 7: 24,981,752 G816D probably damaging Het
Ces1g C T 8: 93,331,239 V145M possibly damaging Het
Clip1 A G 5: 123,642,604 S339P probably damaging Het
Col2a1 G T 15: 97,988,790 T378N unknown Het
Dennd4b ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 3: 90,275,568 probably benign Het
Dnah12 T A 14: 26,861,769 L3207Q probably damaging Het
Efcab5 T C 11: 77,137,258 T416A probably benign Het
Ephb1 A T 9: 102,195,325 I85N probably damaging Het
Etnppl T C 3: 130,620,317 C22R probably damaging Het
F830016B08Rik A G 18: 60,299,877 T11A probably benign Het
Gm5458 C A 14: 19,599,644 V171L probably damaging Het
Helb G T 10: 120,112,998 probably null Het
Hnrnpll A G 17: 80,049,876 V237A possibly damaging Het
Hps3 T C 3: 20,008,868 T712A probably benign Het
Ibsp A G 5: 104,306,030 E78G possibly damaging Het
Ighv1-62-2 G A 12: 115,446,436 A111V probably damaging Het
Igkv4-63 G T 6: 69,378,124 Q58K probably damaging Het
Iqcg T C 16: 33,030,923 Y226C probably damaging Het
Khdc1a A T 1: 21,350,108 D30V possibly damaging Het
Krtap5-5 C A 7: 142,229,787 C42F unknown Het
Lmod3 T C 6: 97,252,553 N7D probably damaging Het
Ms4a4c A G 19: 11,426,229 T192A possibly damaging Het
Ncald A T 15: 37,397,232 V68D probably damaging Het
Olfr1507 T A 14: 52,490,731 T78S probably benign Het
Pcdhgb7 A T 18: 37,752,262 I162F probably damaging Het
Prokr1 T C 6: 87,588,852 T4A possibly damaging Het
Qrich2 T A 11: 116,458,129 probably benign Het
Rgl1 C T 1: 152,586,570 E60K possibly damaging Het
Rtn1 A T 12: 72,408,491 W21R probably benign Het
Spast A G 17: 74,373,358 I438M probably damaging Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tas1r1 A G 4: 152,032,541 I212T probably damaging Het
Tbc1d1 A G 5: 64,275,425 N439D probably damaging Het
Tjp2 C T 19: 24,100,791 A913T probably damaging Het
Tnfrsf26 A G 7: 143,611,757 L47P probably damaging Het
Unc13a A T 8: 71,644,666 S1195T probably damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn1r54 T A 6: 90,269,290 M62K possibly damaging Het
Vmn2r125 A T 4: 156,350,069 D50V probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Vmn2r95 T A 17: 18,443,930 N470K probably damaging Het
Zc3h7a A T 16: 11,147,370 I633N possibly damaging Het
Other mutations in Lvrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Lvrn APN 18 46864666 splice site probably benign
IGL01532:Lvrn APN 18 46900484 missense probably damaging 1.00
IGL02430:Lvrn APN 18 46894730 missense probably benign 0.03
IGL02573:Lvrn APN 18 46876949 missense probably damaging 0.98
IGL02592:Lvrn APN 18 46850591 missense probably damaging 1.00
IGL02754:Lvrn APN 18 46890904 nonsense probably null
IGL03089:Lvrn APN 18 46880709 missense probably damaging 0.99
IGL03209:Lvrn APN 18 46889498 missense probably benign 0.00
IGL03333:Lvrn APN 18 46864664 splice site probably benign
IGL03098:Lvrn UTSW 18 46881410 critical splice acceptor site probably null
R0319:Lvrn UTSW 18 46864753 missense probably damaging 1.00
R0391:Lvrn UTSW 18 46850466 missense probably benign 0.01
R0398:Lvrn UTSW 18 46880693 missense probably benign 0.06
R0432:Lvrn UTSW 18 46905299 missense possibly damaging 0.94
R0456:Lvrn UTSW 18 46864816 critical splice donor site probably null
R1458:Lvrn UTSW 18 46882385 splice site probably benign
R1612:Lvrn UTSW 18 46894703 missense probably damaging 0.99
R1935:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1936:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1959:Lvrn UTSW 18 46894717 missense probably damaging 1.00
R2000:Lvrn UTSW 18 46905307 missense probably benign 0.04
R2022:Lvrn UTSW 18 46866436 missense possibly damaging 0.81
R2106:Lvrn UTSW 18 46878289 missense probably damaging 1.00
R2197:Lvrn UTSW 18 46878342 missense probably benign 0.03
R2371:Lvrn UTSW 18 46878163 splice site probably null
R4125:Lvrn UTSW 18 46876969 missense possibly damaging 0.53
R4606:Lvrn UTSW 18 46864765 missense possibly damaging 0.92
R4830:Lvrn UTSW 18 46905351 missense probably damaging 1.00
R4866:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46881412 missense probably damaging 1.00
R4924:Lvrn UTSW 18 46894725 missense probably damaging 1.00
R4948:Lvrn UTSW 18 46880736 missense probably damaging 1.00
R5167:Lvrn UTSW 18 46880747 missense probably damaging 0.99
R5527:Lvrn UTSW 18 46873803 missense probably damaging 1.00
R5581:Lvrn UTSW 18 46890865 missense probably benign 0.17
R5615:Lvrn UTSW 18 46850328 missense possibly damaging 0.55
R5859:Lvrn UTSW 18 46893749 missense probably damaging 1.00
R6149:Lvrn UTSW 18 46884432 missense probably benign 0.10
R6378:Lvrn UTSW 18 46894957 missense probably benign 0.00
R6838:Lvrn UTSW 18 46890880 missense possibly damaging 0.88
R6993:Lvrn UTSW 18 46882298 missense probably benign 0.18
R7017:Lvrn UTSW 18 46850678 missense probably benign 0.00
R7168:Lvrn UTSW 18 46881322 missense probably benign 0.29
R7190:Lvrn UTSW 18 46900503 missense probably benign 0.02
R7315:Lvrn UTSW 18 46876984 missense probably benign 0.34
R8293:Lvrn UTSW 18 46850565 missense possibly damaging 0.75
R8375:Lvrn UTSW 18 46850222 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCACTTCACTATGATCTGGAGC -3'
(R):5'- CATAGCCCTTACCTGAGCTC -3'

Sequencing Primer
(F):5'- CACTATGATCTGGAGCTGTGGCC -3'
(R):5'- CTGAGCTCATCTTCATCATGGTAGAG -3'
Posted On 2017-10-10