Mutagenetix > Incidental Mutation

Incidental Mutation 'R6175:Nck2'

487653

Institutional Source

Beutler Lab

Gene Symbol

Nck2

Ensembl Gene

ENSMUSG00000066877

Gene Name

non-catalytic region of tyrosine kinase adaptor protein 2

Synonyms

4833426I10Rik, Grb4, NCKbeta

MMRRC Submission

044317-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6175 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43444579-43570515 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 43533569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000140338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086421] [ENSMUST00000187435] [ENSMUST00000202540]

AlphaFold

O55033

Predicted Effect

probably null
Transcript: ENSMUST00000086421
AA Change: M1K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000083611
Gene: ENSMUSG00000066877
AA Change: M1K

Domain	Start	End	E-Value	Type
SH3	5	60	7.06e-17	SMART
SH3	114	169	8.56e-16	SMART
SH3	198	256	2.09e-19	SMART
SH2	283	365	2.86e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114744

SMART Domains

Protein: ENSMUSP00000110392
Gene: ENSMUSG00000066877

Domain	Start	End	E-Value	Type
SH3	5	60	7.06e-17	SMART
SH3	114	169	8.56e-16	SMART
SH3	198	256	2.09e-19	SMART
SH2	283	365	2.86e-28	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000187435
AA Change: M1K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably null
Transcript: ENSMUST00000202540
AA Change: M1K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144224
Gene: ENSMUSG00000066877
AA Change: M1K

Domain	Start	End	E-Value	Type
SH3	5	60	4.3e-19	SMART
PDB:2CUB\|A	106	142	4e-13	PDB
Blast:SH3	114	142	3e-11	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,066,614	K623E	probably damaging	Het
A530064D06Rik	T	A	17: 48,152,848	S227C	possibly damaging	Het
Adam30	A	T	3: 98,162,950	I700F	probably damaging	Het
Adam5	A	T	8: 24,786,151	M500K	probably benign	Het
Adgb	A	T	10: 10,398,943	S755T	possibly damaging	Het
Adgrv1	C	T	13: 81,386,005	G5819D	probably damaging	Het
Ank3	T	A	10: 69,927,727	Y17N	probably damaging	Het
Ano2	A	T	6: 125,992,955	M745L	probably benign	Het
Arap2	A	G	5: 62,714,731		probably null	Het
Atg2a	A	T	19: 6,241,729		probably benign	Het
AU021092	G	T	16: 5,220,448		probably null	Het
Bbs1	A	T	19: 4,890,721	L578Q	probably damaging	Het
Brd9	A	T	13: 73,960,314	E589D	probably damaging	Het
Calr4	A	G	4: 109,244,245	D108G	probably benign	Het
Ccdc82	A	G	9: 13,272,479	D429G	probably damaging	Het
Cdh22	G	T	2: 165,146,630	N268K	probably damaging	Het
Ceacam12	G	A	7: 18,067,387	G97D	probably damaging	Het
Clcn1	A	G	6: 42,314,162	D990G	probably damaging	Het
Cyp2c40	T	C	19: 39,812,560	T84A	probably benign	Het
Dnah7a	G	A	1: 53,433,022	P3529S	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Efna3	GAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGC	3: 89,322,798		probably benign	Het
Ehd2	G	A	7: 15,963,464	Q4*	probably null	Het
Eml5	A	G	12: 98,794,456	V1726A	possibly damaging	Het
Esam	A	G	9: 37,528,248	T10A	probably benign	Het
Fam19a1	A	G	6: 96,115,740	H35R	probably benign	Het
Fbxl6	A	G	15: 76,538,433	L95P	probably benign	Het
Fbxw18	T	A	9: 109,676,879	L441F	probably damaging	Het
Fbxw4	A	G	19: 45,636,327	S73P	probably benign	Het
Fndc1	T	A	17: 7,772,647	H739L	unknown	Het
Foxp1	G	A	6: 98,966,076	T237I	probably damaging	Het
Gm13212	A	T	4: 145,624,241		probably benign	Het
Gm4969	C	A	7: 19,100,889		probably benign	Het
Greb1	A	T	12: 16,674,770	I1801N	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hoxa13	G	T	6: 52,259,928	N281K	probably damaging	Het
Hspg2	A	G	4: 137,569,518	T4328A	probably damaging	Het
Htr2a	C	G	14: 74,645,034	Y153*	probably null	Het
Iglv1	C	A	16: 19,085,094	A92S	probably damaging	Het
Itih1	A	G	14: 30,931,195	S759P	probably damaging	Het
Kctd1	G	T	18: 14,969,631	S831*	probably null	Het
Kif20a	T	A	18: 34,628,146	S265T	probably damaging	Het
Kif22	T	A	7: 127,031,056	E436V	possibly damaging	Het
Kif27	A	G	13: 58,311,237	W927R	probably damaging	Het
Lcorl	G	A	5: 45,776,490	P66L	probably damaging	Het
Lct	A	G	1: 128,327,714	L197P	probably damaging	Het
Lefty1	T	C	1: 180,935,149	S14P	unknown	Het
Lnp1	A	G	16: 56,917,492	S78P	possibly damaging	Het
Map3k19	A	T	1: 127,822,832	H927Q	probably benign	Het
Mta3	A	G	17: 83,791,793	T430A	probably benign	Het
Muc2	G	T	7: 141,696,632	C627F	probably damaging	Het
Myh13	A	G	11: 67,354,762	D1076G	probably benign	Het
Nipal1	A	G	5: 72,663,555	N131S	probably damaging	Het
Nlrp9c	T	C	7: 26,378,001		probably null	Het
Nr2f2	A	G	7: 70,358,198	S179P	probably damaging	Het
Olfr1013	A	T	2: 85,770,308	N169I	probably benign	Het
Olfr345	A	G	2: 36,640,051	D4G	probably benign	Het
Olfr50	A	T	2: 36,793,968	H244L	probably damaging	Het
Oxt	G	T	2: 130,576,243		probably benign	Het
Pank2	T	A	2: 131,280,261	Y235*	probably null	Het
Pear1	A	G	3: 87,752,133	L798P	possibly damaging	Het
Pex14	T	C	4: 148,961,699	H258R	probably benign	Het
Pmpcb	A	G	5: 21,757,033	I487V	probably benign	Het
Ppie	T	C	4: 123,137,569	E44G	probably benign	Het
Ppp1r9a	A	T	6: 4,905,639	R65*	probably null	Het
Ralgapb	T	C	2: 158,446,155	S371P	probably damaging	Het
Ros1	T	C	10: 52,101,785	H1455R	probably benign	Het
Sacs	C	A	14: 61,212,826	T4107K	possibly damaging	Het
Sec24a	G	A	11: 51,731,891	T386M	probably damaging	Het
Slc10a4	A	T	5: 73,012,250	Y207F	possibly damaging	Het
Slc30a10	T	C	1: 185,455,311	L83P	probably damaging	Het
Slc38a9	T	A	13: 112,703,559	L324*	probably null	Het
Slc7a9	A	T	7: 35,465,852	Q474L	probably damaging	Het
Smc5	C	A	19: 23,214,170	V875L	possibly damaging	Het
Snap91	T	C	9: 86,825,000	R246G	probably damaging	Het
Sned1	A	G	1: 93,275,474		probably null	Het
Spink14	G	A	18: 44,031,871	G85E	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
St13	A	G	15: 81,399,305		probably null	Het
Stk10	A	G	11: 32,603,761	M593V	possibly damaging	Het
Tex21	C	A	12: 76,198,933	A530S	probably benign	Het
Tln2	T	A	9: 67,224,081	K1394N	probably damaging	Het
Trhr2	C	A	8: 122,357,379	R294L	probably damaging	Het
Unc79	A	T	12: 103,183,449	I2408F	probably damaging	Het
Wdr24	T	C	17: 25,826,578	L429P	probably damaging	Het
Wwp2	T	A	8: 107,483,407	I139N	possibly damaging	Het
Zfp111	G	A	7: 24,198,129	R686C	unknown	Het
Zyg11a	A	G	4: 108,189,681	V532A	probably benign	Het

Other mutations in Nck2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
wake	UTSW	1	43554260	missense	probably benign
R0420:Nck2	UTSW	1	43554118	missense	probably damaging	1.00
R0503:Nck2	UTSW	1	43533568	start codon destroyed	probably null	0.96
R0538:Nck2	UTSW	1	43569144	splice site	probably benign
R1080:Nck2	UTSW	1	43533581	missense	probably benign	0.00
R2509:Nck2	UTSW	1	43554233	missense	probably damaging	1.00
R4029:Nck2	UTSW	1	43554091	missense	probably benign
R4923:Nck2	UTSW	1	43461071	intron	probably benign
R5425:Nck2	UTSW	1	43554392	missense	probably benign	0.05
R6683:Nck2	UTSW	1	43569178	missense	probably benign
R6859:Nck2	UTSW	1	43554351	missense	probably benign	0.24
R7514:Nck2	UTSW	1	43569221	missense	probably benign	0.00
R8021:Nck2	UTSW	1	43554260	missense	probably benign
R8278:Nck2	UTSW	1	43554580	missense	probably damaging	1.00
R9004:Nck2	UTSW	1	43554350	missense
R9063:Nck2	UTSW	1	43554343	missense	possibly damaging	0.91
R9559:Nck2	UTSW	1	43554047	missense	probably damaging	1.00
R9746:Nck2	UTSW	1	43533732	nonsense	probably null
Z1088:Nck2	UTSW	1	43554383	missense	possibly damaging	0.55
Z1177:Nck2	UTSW	1	43554356	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGGCTGCAGGCTTTGATTAC -3'
(R):5'- GTTCTTACGCTCCACATAGTTGG -3'

Sequencing Primer
(F):5'- GTTTCTCAGCAGCATTAGAGC -3'
(R):5'- TTACGCTCCACATAGTTGGAAGGC -3'

Posted On

2017-10-10