Incidental Mutation 'R6175:Hjurp'
ID 487655
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
MMRRC Submission 044317-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R6175 (G1)
Quality Score 217.468
Status Validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) GT to GTT at 88194246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,902,448 (GRCm39) K623E probably damaging Het
A530064D06Rik T A 17: 48,460,016 (GRCm39) S227C possibly damaging Het
Adam30 A T 3: 98,070,266 (GRCm39) I700F probably damaging Het
Adam5 A T 8: 25,276,167 (GRCm39) M500K probably benign Het
Adgb A T 10: 10,274,687 (GRCm39) S755T possibly damaging Het
Adgrv1 C T 13: 81,534,124 (GRCm39) G5819D probably damaging Het
Ank3 T A 10: 69,763,557 (GRCm39) Y17N probably damaging Het
Ano2 A T 6: 125,969,918 (GRCm39) M745L probably benign Het
Arap2 A G 5: 62,872,074 (GRCm39) probably null Het
Atg2a A T 19: 6,291,759 (GRCm39) probably benign Het
AU021092 G T 16: 5,038,312 (GRCm39) probably null Het
Bbs1 A T 19: 4,940,749 (GRCm39) L578Q probably damaging Het
Brd9 A T 13: 74,108,433 (GRCm39) E589D probably damaging Het
Calr4 A G 4: 109,101,442 (GRCm39) D108G probably benign Het
Ccdc82 A G 9: 13,272,798 (GRCm39) D429G probably damaging Het
Cdh22 G T 2: 164,988,550 (GRCm39) N268K probably damaging Het
Ceacam12 G A 7: 17,801,312 (GRCm39) G97D probably damaging Het
Clcn1 A G 6: 42,291,096 (GRCm39) D990G probably damaging Het
Cyp2c40 T C 19: 39,801,004 (GRCm39) T84A probably benign Het
Dnah7a G A 1: 53,472,181 (GRCm39) P3529S probably damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,230,105 (GRCm39) probably benign Het
Ehd2 G A 7: 15,697,389 (GRCm39) Q4* probably null Het
Eml5 A G 12: 98,760,715 (GRCm39) V1726A possibly damaging Het
Esam A G 9: 37,439,544 (GRCm39) T10A probably benign Het
Fbxl6 A G 15: 76,422,633 (GRCm39) L95P probably benign Het
Fbxw18 T A 9: 109,505,947 (GRCm39) L441F probably damaging Het
Fbxw4 A G 19: 45,624,766 (GRCm39) S73P probably benign Het
Fndc1 T A 17: 7,991,479 (GRCm39) H739L unknown Het
Foxp1 G A 6: 98,943,037 (GRCm39) T237I probably damaging Het
Greb1 A T 12: 16,724,771 (GRCm39) I1801N probably damaging Het
Hoxa13 G T 6: 52,236,908 (GRCm39) N281K probably damaging Het
Hspg2 A G 4: 137,296,829 (GRCm39) T4328A probably damaging Het
Htr2a C G 14: 74,882,474 (GRCm39) Y153* probably null Het
Iglv1 C A 16: 18,903,844 (GRCm39) A92S probably damaging Het
Itih1 A G 14: 30,653,152 (GRCm39) S759P probably damaging Het
Kctd1 G T 18: 15,102,688 (GRCm39) S831* probably null Het
Kif20a T A 18: 34,761,199 (GRCm39) S265T probably damaging Het
Kif22 T A 7: 126,630,228 (GRCm39) E436V possibly damaging Het
Kif27 A G 13: 58,459,051 (GRCm39) W927R probably damaging Het
Lcorl G A 5: 45,933,832 (GRCm39) P66L probably damaging Het
Lct A G 1: 128,255,451 (GRCm39) L197P probably damaging Het
Lefty1 T C 1: 180,762,714 (GRCm39) S14P unknown Het
Lnp1 A G 16: 56,737,855 (GRCm39) S78P possibly damaging Het
Map3k19 A T 1: 127,750,569 (GRCm39) H927Q probably benign Het
Meiosin C A 7: 18,834,814 (GRCm39) probably benign Het
Mta3 A G 17: 84,099,222 (GRCm39) T430A probably benign Het
Muc2 G T 7: 141,282,875 (GRCm39) C627F probably damaging Het
Myh13 A G 11: 67,245,588 (GRCm39) D1076G probably benign Het
Nck2 T A 1: 43,572,729 (GRCm39) M1K probably null Het
Nipal1 A G 5: 72,820,898 (GRCm39) N131S probably damaging Het
Nlrp9c T C 7: 26,077,426 (GRCm39) probably null Het
Nr2f2 A G 7: 70,007,946 (GRCm39) S179P probably damaging Het
Or1j16 A G 2: 36,530,063 (GRCm39) D4G probably benign Het
Or1j21 A T 2: 36,683,980 (GRCm39) H244L probably damaging Het
Or9g19 A T 2: 85,600,652 (GRCm39) N169I probably benign Het
Oxt G T 2: 130,418,163 (GRCm39) probably benign Het
Pank2 T A 2: 131,122,181 (GRCm39) Y235* probably null Het
Pear1 A G 3: 87,659,440 (GRCm39) L798P possibly damaging Het
Pex14 T C 4: 149,046,156 (GRCm39) H258R probably benign Het
Pmpcb A G 5: 21,962,031 (GRCm39) I487V probably benign Het
Ppie T C 4: 123,031,362 (GRCm39) E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 (GRCm39) R65* probably null Het
Ralgapb T C 2: 158,288,075 (GRCm39) S371P probably damaging Het
Ros1 T C 10: 51,977,881 (GRCm39) H1455R probably benign Het
Sacs C A 14: 61,450,275 (GRCm39) T4107K possibly damaging Het
Sec24a G A 11: 51,622,718 (GRCm39) T386M probably damaging Het
Slc10a4 A T 5: 73,169,593 (GRCm39) Y207F possibly damaging Het
Slc30a10 T C 1: 185,187,508 (GRCm39) L83P probably damaging Het
Slc38a9 T A 13: 112,840,093 (GRCm39) L324* probably null Het
Slc7a9 A T 7: 35,165,277 (GRCm39) Q474L probably damaging Het
Smc5 C A 19: 23,191,534 (GRCm39) V875L possibly damaging Het
Snap91 T C 9: 86,707,053 (GRCm39) R246G probably damaging Het
Sned1 A G 1: 93,203,196 (GRCm39) probably null Het
Spink14 G A 18: 44,164,938 (GRCm39) G85E probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
St13 A G 15: 81,283,506 (GRCm39) probably null Het
Stk10 A G 11: 32,553,761 (GRCm39) M593V possibly damaging Het
Tafa1 A G 6: 96,092,721 (GRCm39) H35R probably benign Het
Tex21 C A 12: 76,245,707 (GRCm39) A530S probably benign Het
Tln2 T A 9: 67,131,363 (GRCm39) K1394N probably damaging Het
Trhr2 C A 8: 123,084,118 (GRCm39) R294L probably damaging Het
Unc79 A T 12: 103,149,708 (GRCm39) I2408F probably damaging Het
Wdr24 T C 17: 26,045,552 (GRCm39) L429P probably damaging Het
Wwp2 T A 8: 108,210,039 (GRCm39) I139N possibly damaging Het
Zfp111 G A 7: 23,897,554 (GRCm39) R686C unknown Het
Zfp268 A T 4: 145,350,811 (GRCm39) probably benign Het
Zyg11a A G 4: 108,046,878 (GRCm39) V532A probably benign Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1992:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2002:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2871:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6087:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9475:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- AACTGTCATGGTTTGTGATGCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On 2017-10-10