Incidental Mutation 'R0524:Hps3'
ID 48766
Institutional Source Beutler Lab
Gene Symbol Hps3
Ensembl Gene ENSMUSG00000027615
Gene Name HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms Hermansky-Pudlak syndrome 3
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R0524 (G1)
Quality Score 221
Status Not validated
Chromosome 3
Chromosomal Location 20050109-20089478 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20066940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 542 (V542E)
Ref Sequence ENSEMBL: ENSMUSP00000103957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000012580] [ENSMUST00000108321]
AlphaFold Q91VB4
Predicted Effect probably benign
Transcript: ENSMUST00000003714
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000012580
AA Change: V674E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: V674E

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108321
AA Change: V542E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: V542E

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155121
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Hps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20,073,971 (GRCm39) missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20,079,956 (GRCm39) missense probably benign 0.00
IGL01320:Hps3 APN 3 20,084,633 (GRCm39) missense probably benign 0.12
IGL01364:Hps3 APN 3 20,057,469 (GRCm39) missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20,065,130 (GRCm39) missense probably damaging 1.00
IGL01843:Hps3 APN 3 20,083,165 (GRCm39) missense probably benign 0.05
IGL02294:Hps3 APN 3 20,068,212 (GRCm39) missense probably damaging 1.00
IGL02581:Hps3 APN 3 20,057,385 (GRCm39) intron probably benign
Blue UTSW 3 20,084,960 (GRCm39) missense probably damaging 1.00
earl_grey UTSW 3 20,017,173 (GRCm38) intron probably benign
gandalf UTSW 3 20,066,960 (GRCm39) nonsense probably null
pam_gray UTSW 3 20,017,173 (GRCm38) intron probably benign
R0107:Hps3 UTSW 3 20,084,960 (GRCm39) missense probably damaging 1.00
R0245:Hps3 UTSW 3 20,066,960 (GRCm39) nonsense probably null
R0421:Hps3 UTSW 3 20,083,480 (GRCm39) missense probably benign 0.00
R0763:Hps3 UTSW 3 20,057,443 (GRCm39) missense probably damaging 1.00
R1795:Hps3 UTSW 3 20,066,859 (GRCm39) critical splice donor site probably null
R1864:Hps3 UTSW 3 20,074,123 (GRCm39) critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20,084,691 (GRCm39) missense probably benign 0.01
R2101:Hps3 UTSW 3 20,066,947 (GRCm39) missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20,056,527 (GRCm39) missense probably benign
R2268:Hps3 UTSW 3 20,067,099 (GRCm39) splice site probably benign
R2520:Hps3 UTSW 3 20,083,194 (GRCm39) missense probably damaging 1.00
R3809:Hps3 UTSW 3 20,072,976 (GRCm39) missense probably damaging 1.00
R3888:Hps3 UTSW 3 20,057,387 (GRCm39) critical splice donor site probably null
R3942:Hps3 UTSW 3 20,051,103 (GRCm39) missense probably damaging 1.00
R4022:Hps3 UTSW 3 20,089,425 (GRCm39) missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20,083,393 (GRCm39) missense probably damaging 1.00
R4739:Hps3 UTSW 3 20,084,574 (GRCm39) critical splice acceptor site probably null
R4823:Hps3 UTSW 3 20,066,890 (GRCm39) missense probably benign 0.03
R4912:Hps3 UTSW 3 20,068,337 (GRCm39) missense probably damaging 1.00
R5307:Hps3 UTSW 3 20,066,865 (GRCm39) missense possibly damaging 0.89
R5859:Hps3 UTSW 3 20,063,034 (GRCm39) missense probably benign 0.02
R6140:Hps3 UTSW 3 20,051,151 (GRCm39) missense probably damaging 1.00
R6183:Hps3 UTSW 3 20,063,032 (GRCm39) missense probably benign 0.04
R6971:Hps3 UTSW 3 20,065,699 (GRCm39) missense probably damaging 1.00
R6981:Hps3 UTSW 3 20,076,984 (GRCm39) missense probably damaging 1.00
R7120:Hps3 UTSW 3 20,065,705 (GRCm39) missense probably damaging 1.00
R7146:Hps3 UTSW 3 20,063,050 (GRCm39) missense probably damaging 1.00
R7223:Hps3 UTSW 3 20,084,583 (GRCm39) missense probably benign 0.05
R7448:Hps3 UTSW 3 20,089,329 (GRCm39) missense probably damaging 0.99
R7452:Hps3 UTSW 3 20,065,592 (GRCm39) missense probably damaging 1.00
R7560:Hps3 UTSW 3 20,084,616 (GRCm39) missense probably benign 0.29
R7659:Hps3 UTSW 3 20,076,978 (GRCm39) nonsense probably null
R7769:Hps3 UTSW 3 20,072,972 (GRCm39) splice site probably null
R8050:Hps3 UTSW 3 20,057,492 (GRCm39) missense probably benign
R8242:Hps3 UTSW 3 20,068,290 (GRCm39) missense possibly damaging 0.59
R8802:Hps3 UTSW 3 20,074,070 (GRCm39) missense probably damaging 1.00
R8822:Hps3 UTSW 3 20,057,391 (GRCm39) missense probably benign
R8945:Hps3 UTSW 3 20,068,224 (GRCm39) missense probably damaging 0.99
R9111:Hps3 UTSW 3 20,084,575 (GRCm39) critical splice acceptor site probably null
R9131:Hps3 UTSW 3 20,083,350 (GRCm39) missense probably damaging 0.98
R9645:Hps3 UTSW 3 20,084,831 (GRCm39) missense probably benign 0.01
R9728:Hps3 UTSW 3 20,065,128 (GRCm39) missense probably benign 0.06
X0021:Hps3 UTSW 3 20,084,913 (GRCm39) missense probably benign 0.14
X0066:Hps3 UTSW 3 20,070,152 (GRCm39) missense probably damaging 1.00
Z1177:Hps3 UTSW 3 20,063,065 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTTGTGCTTTCAGTGAACACC -3'
(R):5'- AGCAGCAAAAGTGGCTCAGATATTCC -3'

Sequencing Primer
(F):5'- TGGCTCTGGACATAGCTTTATAC -3'
(R):5'- TCAGATATTCCACATGGCTGAGC -3'
Posted On 2013-06-12