Incidental Mutation 'R6175:Cdh22'
ID487665
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission 044317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R6175 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 165146630 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 268 (N268K)
Ref Sequence ENSEMBL: ENSMUSP00000066864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
Predicted Effect probably damaging
Transcript: ENSMUST00000065438
AA Change: N268K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: N268K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138643
AA Change: N268K

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166
AA Change: N268K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgb A T 10: 10,398,943 S755T possibly damaging Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Brd9 A T 13: 73,960,314 E589D probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah7a G A 1: 53,433,022 P3529S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nlrp9c T C 7: 26,378,001 probably null Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Slc7a9 A T 7: 35,465,852 Q474L probably damaging Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
St13 A G 15: 81,399,305 probably null Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Tln2 T A 9: 67,224,081 K1394N probably damaging Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165181056 missense probably damaging 0.98
R1192:Cdh22 UTSW 2 165135283 missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2270:Cdh22 UTSW 2 165143847 splice site probably null
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R5649:Cdh22 UTSW 2 165116280 missense probably damaging 1.00
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165170692 missense probably damaging 0.97
R7294:Cdh22 UTSW 2 165142093 missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 165112294 nonsense probably null
R7595:Cdh22 UTSW 2 165112463 missense probably benign 0.00
R7601:Cdh22 UTSW 2 165112546 missense probably damaging 1.00
R8047:Cdh22 UTSW 2 165170767 missense probably damaging 1.00
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Z1176:Cdh22 UTSW 2 165116184 missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 165146680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTTCTGTTTGCAAAACCAGAC -3'
(R):5'- ATGGCAGAGGCATGCTTTGG -3'

Sequencing Primer
(F):5'- AGACTGGTAAGGGCTTCCC -3'
(R):5'- AGAGTCTGCCACCATGTCC -3'
Posted On2017-10-10