Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Pcdh18'

48767

Institutional Source

Beutler Lab

Gene Symbol

Pcdh18

Ensembl Gene

ENSMUSG00000037892

Gene Name

protocadherin 18

Synonyms

PCDH68L

MMRRC Submission

038717-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49743296-49757325 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49755642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 408 (Q408R)

Ref Sequence

ENSEMBL: ENSMUSP00000141995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]

AlphaFold

Q8VHR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035931
AA Change: Q408R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: Q408R

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
CA	51	135	1.36e-1	SMART
CA	159	244	3.78e-20	SMART
CA	268	352	1.12e-22	SMART
CA	382	463	5.76e-25	SMART
CA	487	574	2.51e-25	SMART
CA	603	684	8e-3	SMART
transmembrane domain	698	720	N/A	INTRINSIC
low complexity region	772	783	N/A	INTRINSIC
low complexity region	988	1009	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000191794
AA Change: Q408R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: Q408R

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	51	135	6.6e-4	SMART
CA	159	244	1.9e-22	SMART
CA	268	352	5.6e-25	SMART
CA	382	463	2.7e-27	SMART
CA	487	574	1.2e-27	SMART
CA	603	684	3.9e-5	SMART
transmembrane domain	698	720	N/A	INTRINSIC
low complexity region	772	783	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193600

Predicted Effect

probably benign
Transcript: ENSMUST00000194603

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195086

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Pcdh18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Pcdh18	APN	3	49753379	missense	probably damaging	1.00
IGL00639:Pcdh18	APN	3	49755616	missense	probably benign	0.34
IGL00954:Pcdh18	APN	3	49756389	missense	probably damaging	1.00
IGL01338:Pcdh18	APN	3	49756141	missense	probably damaging	1.00
IGL01339:Pcdh18	APN	3	49755798	missense	probably benign	0.35
IGL01687:Pcdh18	APN	3	49753533	splice site	probably benign
IGL01727:Pcdh18	APN	3	49755700	missense	probably damaging	0.99
IGL01788:Pcdh18	APN	3	49755922	nonsense	probably null
IGL01824:Pcdh18	APN	3	49754774	missense	probably damaging	1.00
IGL01834:Pcdh18	APN	3	49756830	missense	probably benign	0.03
IGL01913:Pcdh18	APN	3	49755249	missense	possibly damaging	0.94
IGL01915:Pcdh18	APN	3	49744921	missense	probably benign
IGL02095:Pcdh18	APN	3	49756156	missense	probably benign	0.01
IGL02128:Pcdh18	APN	3	49756686	missense	possibly damaging	0.65
IGL02302:Pcdh18	APN	3	49755938	missense	probably benign
IGL02342:Pcdh18	APN	3	49756044	missense	probably damaging	1.00
IGL02440:Pcdh18	APN	3	49744603	utr 3 prime	probably benign
IGL02499:Pcdh18	APN	3	49753447	missense	probably benign	0.15
IGL02570:Pcdh18	APN	3	49756625	missense	probably benign	0.02
IGL02745:Pcdh18	APN	3	49755891	missense	probably damaging	1.00
IGL03073:Pcdh18	APN	3	49753367	missense	possibly damaging	0.93
PIT4469001:Pcdh18	UTSW	3	49755069	missense	probably benign
R0078:Pcdh18	UTSW	3	49756344	missense	probably damaging	1.00
R0196:Pcdh18	UTSW	3	49756698	splice site	probably null
R0661:Pcdh18	UTSW	3	49753318	missense	possibly damaging	0.64
R0900:Pcdh18	UTSW	3	49756803	missense	probably benign	0.25
R1101:Pcdh18	UTSW	3	49753379	missense	probably damaging	1.00
R1463:Pcdh18	UTSW	3	49755405	missense	probably damaging	0.99
R1778:Pcdh18	UTSW	3	49755634	missense	probably benign	0.19
R1850:Pcdh18	UTSW	3	49756405	missense	probably benign	0.22
R1875:Pcdh18	UTSW	3	49754705	missense	probably damaging	0.99
R1903:Pcdh18	UTSW	3	49755447	missense	probably benign
R1956:Pcdh18	UTSW	3	49755951	missense	probably benign
R2044:Pcdh18	UTSW	3	49754940	missense	probably benign
R2303:Pcdh18	UTSW	3	49755274	missense	probably damaging	1.00
R3732:Pcdh18	UTSW	3	49754791	missense	probably benign
R3732:Pcdh18	UTSW	3	49754791	missense	probably benign
R3733:Pcdh18	UTSW	3	49754791	missense	probably benign
R3973:Pcdh18	UTSW	3	49754586	missense	probably damaging	1.00
R4281:Pcdh18	UTSW	3	49756533	missense	possibly damaging	0.76
R4601:Pcdh18	UTSW	3	49744725	missense	probably damaging	1.00
R4631:Pcdh18	UTSW	3	49756441	missense	probably damaging	0.99
R4752:Pcdh18	UTSW	3	49755114	missense	probably damaging	1.00
R4840:Pcdh18	UTSW	3	49744668	missense	probably damaging	0.98
R4867:Pcdh18	UTSW	3	49754664	missense	probably damaging	1.00
R5007:Pcdh18	UTSW	3	49754457	missense	probably benign	0.23
R5039:Pcdh18	UTSW	3	49754856	missense	probably benign
R5169:Pcdh18	UTSW	3	49755966	missense	possibly damaging	0.65
R5438:Pcdh18	UTSW	3	49756016	nonsense	probably null
R5579:Pcdh18	UTSW	3	49744977	missense	probably damaging	1.00
R6000:Pcdh18	UTSW	3	49754464	missense	probably damaging	0.99
R6220:Pcdh18	UTSW	3	49745251	missense	probably damaging	1.00
R6737:Pcdh18	UTSW	3	49755895	missense	probably damaging	0.98
R6789:Pcdh18	UTSW	3	49755915	missense	probably benign	0.00
R7011:Pcdh18	UTSW	3	49754782	missense	probably benign
R7146:Pcdh18	UTSW	3	49755822	missense	probably damaging	1.00
R7150:Pcdh18	UTSW	3	49754694	missense	probably benign	0.31
R7205:Pcdh18	UTSW	3	49755474	missense	probably benign
R7326:Pcdh18	UTSW	3	49756860	missense	probably benign
R7413:Pcdh18	UTSW	3	49744783	missense	possibly damaging	0.94
R7755:Pcdh18	UTSW	3	49754829	missense	possibly damaging	0.59
R7848:Pcdh18	UTSW	3	49755997	missense	possibly damaging	0.54
R8169:Pcdh18	UTSW	3	49745235	missense	probably damaging	1.00
R8264:Pcdh18	UTSW	3	49756581	missense	probably damaging	1.00
R8352:Pcdh18	UTSW	3	49745175	missense	possibly damaging	0.81
R8406:Pcdh18	UTSW	3	49756549	missense	probably damaging	1.00
R8452:Pcdh18	UTSW	3	49745175	missense	possibly damaging	0.81
R8489:Pcdh18	UTSW	3	49754589	missense	probably damaging	1.00
R8526:Pcdh18	UTSW	3	49755574	missense	probably damaging	1.00
R9075:Pcdh18	UTSW	3	49744890	missense	probably benign
R9285:Pcdh18	UTSW	3	49753337	missense	probably damaging	0.97
R9316:Pcdh18	UTSW	3	49754640	missense	probably damaging	1.00
R9339:Pcdh18	UTSW	3	49754886	missense	probably damaging	1.00
R9410:Pcdh18	UTSW	3	49745166	missense	probably damaging	1.00
R9425:Pcdh18	UTSW	3	49754602	missense	possibly damaging	0.81
R9432:Pcdh18	UTSW	3	49745218	missense	probably damaging	0.96
R9547:Pcdh18	UTSW	3	49755057	missense	possibly damaging	0.79
R9567:Pcdh18	UTSW	3	49756435	missense	possibly damaging	0.95
R9622:Pcdh18	UTSW	3	49756780	missense	probably benign	0.20
R9687:Pcdh18	UTSW	3	49756587	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATATCGGCTCCTCTGGAAGCG -3'
(R):5'- GGCCTTTGAGCAGCCTTCTTACAC -3'

Sequencing Primer
(F):5'- TCCTCTGGAAGCGAGGTG -3'
(R):5'- attctttcagcagtcatgtgtc -3'

Posted On

2013-06-12