Incidental Mutation 'R0524:Bnipl'
ID 48768
Institutional Source Beutler Lab
Gene Symbol Bnipl
Ensembl Gene ENSMUSG00000028115
Gene Name BCL2/adenovirus E1B 19kD interacting protein like
Synonyms BNIPL-1, BNIPL2, BNIPL1, BNIP-S, BNIPL, BNIPL-2, PP753, 1700128A13Rik
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 95148587-95158504 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95157140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000115197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015855] [ENSMUST00000098871] [ENSMUST00000107195] [ENSMUST00000125515] [ENSMUST00000137250]
AlphaFold Q99JU7
Predicted Effect probably benign
Transcript: ENSMUST00000015855
SMART Domains Protein: ENSMUSP00000015855
Gene: ENSMUSG00000015711

DomainStartEndE-ValueType
Pfam:DHH 19 181 2.5e-10 PFAM
DHHA2 215 359 1.88e-33 SMART
Predicted Effect unknown
Transcript: ENSMUST00000098871
AA Change: D29G
SMART Domains Protein: ENSMUSP00000096468
Gene: ENSMUSG00000028115
AA Change: D29G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 4.5e-38 PFAM
Pfam:CRAL_TRIO_2 162 273 7.7e-16 PFAM
Pfam:CRAL_TRIO 196 263 3.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107195
AA Change: D61G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102813
Gene: ENSMUSG00000028115
AA Change: D61G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
SEC14 193 348 7.89e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125515
AA Change: D29G
SMART Domains Protein: ENSMUSP00000120545
Gene: ENSMUSG00000028115
AA Change: D29G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 3.7e-38 PFAM
Pfam:CRAL_TRIO_2 168 259 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137250
AA Change: D33G

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115197
Gene: ENSMUSG00000028115
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
SEC14 165 320 7.89e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176070
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with several other proteins, such as BCL2, ARHGAP1, MIF and GFER. It may function as a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Bnipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Bnipl APN 3 95,150,045 (GRCm39) missense probably damaging 1.00
IGL02089:Bnipl APN 3 95,157,577 (GRCm39) splice site probably benign
IGL02273:Bnipl APN 3 95,153,086 (GRCm39) missense possibly damaging 0.58
IGL03250:Bnipl APN 3 95,151,450 (GRCm39) splice site probably benign
R1181:Bnipl UTSW 3 95,152,960 (GRCm39) critical splice donor site probably null
R1926:Bnipl UTSW 3 95,150,354 (GRCm39) missense probably damaging 1.00
R2072:Bnipl UTSW 3 95,151,522 (GRCm39) missense probably damaging 1.00
R2126:Bnipl UTSW 3 95,152,994 (GRCm39) missense probably damaging 1.00
R2196:Bnipl UTSW 3 95,157,181 (GRCm39) missense possibly damaging 0.83
R2898:Bnipl UTSW 3 95,150,360 (GRCm39) missense probably benign 0.44
R7781:Bnipl UTSW 3 95,151,486 (GRCm39) missense probably damaging 1.00
R7885:Bnipl UTSW 3 95,157,551 (GRCm39) missense probably benign
R9088:Bnipl UTSW 3 95,158,295 (GRCm39) nonsense probably null
R9512:Bnipl UTSW 3 95,150,369 (GRCm39) missense probably benign 0.36
R9789:Bnipl UTSW 3 95,153,140 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCTGTGCATTTTGAGAAAGGGATGTAAC -3'
(R):5'- AGCAACCATGAAACTTGGAGAGCTG -3'

Sequencing Primer
(F):5'- CAACAGTGCCAGAAGTCAAC -3'
(R):5'- cctctctgtcatcctttgctc -3'
Posted On 2013-06-12