Incidental Mutation 'R0524:Bnipl'
List |< first << previous [record 4 of 51] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Bnipl
Ensembl Gene ENSMUSG00000028115
Gene NameBCL2/adenovirus E1B 19kD interacting protein like
SynonymsPP753, BNIPL1, 1700128A13Rik, BNIP-S, BNIPL2, BNIPL, BNIPL-2, BNIPL-1
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosomal Location95241271-95251193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95249829 bp
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000115197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015855] [ENSMUST00000098871] [ENSMUST00000107195] [ENSMUST00000125515] [ENSMUST00000137250]
Predicted Effect probably benign
Transcript: ENSMUST00000015855
SMART Domains Protein: ENSMUSP00000015855
Gene: ENSMUSG00000015711

Pfam:DHH 19 181 2.5e-10 PFAM
DHHA2 215 359 1.88e-33 SMART
Predicted Effect unknown
Transcript: ENSMUST00000098871
AA Change: D29G
SMART Domains Protein: ENSMUSP00000096468
Gene: ENSMUSG00000028115
AA Change: D29G

low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 4.5e-38 PFAM
Pfam:CRAL_TRIO_2 162 273 7.7e-16 PFAM
Pfam:CRAL_TRIO 196 263 3.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107195
AA Change: D61G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102813
Gene: ENSMUSG00000028115
AA Change: D61G

low complexity region 33 44 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
SEC14 193 348 7.89e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125515
AA Change: D29G
SMART Domains Protein: ENSMUSP00000120545
Gene: ENSMUSG00000028115
AA Change: D29G

low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 3.7e-38 PFAM
Pfam:CRAL_TRIO_2 168 259 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137250
AA Change: D33G

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115197
Gene: ENSMUSG00000028115
AA Change: D33G

low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
SEC14 165 320 7.89e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176070
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with several other proteins, such as BCL2, ARHGAP1, MIF and GFER. It may function as a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Bnipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Bnipl APN 3 95242734 missense probably damaging 1.00
IGL02089:Bnipl APN 3 95250266 splice site probably benign
IGL02273:Bnipl APN 3 95245775 missense possibly damaging 0.58
IGL03250:Bnipl APN 3 95244139 splice site probably benign
R1181:Bnipl UTSW 3 95245649 critical splice donor site probably null
R1926:Bnipl UTSW 3 95243043 missense probably damaging 1.00
R2072:Bnipl UTSW 3 95244211 missense probably damaging 1.00
R2126:Bnipl UTSW 3 95245683 missense probably damaging 1.00
R2196:Bnipl UTSW 3 95249870 missense possibly damaging 0.83
R2898:Bnipl UTSW 3 95243049 missense probably benign 0.44
R7781:Bnipl UTSW 3 95244175 missense probably damaging 1.00
R7885:Bnipl UTSW 3 95250240 missense probably benign
R7968:Bnipl UTSW 3 95250240 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cctctctgtcatcctttgctc -3'
Posted On2013-06-12