Incidental Mutation 'R6175:Slc7a9'
ID487691
Institutional Source Beutler Lab
Gene Symbol Slc7a9
Ensembl Gene ENSMUSG00000030492
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonymsb, + amino acid transporter, CSNU3, b, +AT
MMRRC Submission 044317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6175 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35448796-35466036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35465852 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 474 (Q474L)
Ref Sequence ENSEMBL: ENSMUSP00000112726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032703] [ENSMUST00000118383] [ENSMUST00000118969] [ENSMUST00000193633]
Predicted Effect probably damaging
Transcript: ENSMUST00000032703
AA Change: Q474L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032703
Gene: ENSMUSG00000030492
AA Change: Q474L

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118383
AA Change: Q474L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113181
Gene: ENSMUSG00000030492
AA Change: Q474L

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118969
AA Change: Q474L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112726
Gene: ENSMUSG00000030492
AA Change: Q474L

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 457 1.8e-65 PFAM
Pfam:AA_permease 35 468 2.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147026
Predicted Effect probably benign
Transcript: ENSMUST00000193633
SMART Domains Protein: ENSMUSP00000141796
Gene: ENSMUSG00000030491

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 2.7e-24 PFAM
Pfam:DEAD 273 606 7.6e-7 PFAM
Meta Mutation Damage Score 0.9070 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of light subunits of amino acid transporters. This protein plays a role in the high-affinity and sodium-independent transport of cystine and neutral and dibasic amino acids, and appears to function in the reabsorption of cystine in the kidney tubule. Mutations in this gene cause non-type I cystinuria, a disease that leads to cystine stones in the urinary system due to impaired transport of cystine and dibasic amino acids. Alternate transcript variants, which encode the same protein, have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Inactivation of this locus leads to renal absorption defects and cystine urolithiasis, similar to the symptoms observed in patients with cystinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgb A T 10: 10,398,943 S755T possibly damaging Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Brd9 A T 13: 73,960,314 E589D probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Cdh22 G T 2: 165,146,630 N268K probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah7a G A 1: 53,433,022 P3529S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nlrp9c T C 7: 26,378,001 probably null Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
St13 A G 15: 81,399,305 probably null Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Tln2 T A 9: 67,224,081 K1394N probably damaging Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Slc7a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Slc7a9 APN 7 35460887 missense probably damaging 0.97
IGL01538:Slc7a9 APN 7 35454164 missense probably damaging 0.97
IGL01860:Slc7a9 APN 7 35457060 missense probably damaging 1.00
IGL02291:Slc7a9 APN 7 35457014 missense probably damaging 1.00
IGL02436:Slc7a9 APN 7 35457053 missense probably benign 0.23
IGL02525:Slc7a9 APN 7 35453435 missense probably damaging 1.00
IGL03296:Slc7a9 APN 7 35452427 missense probably damaging 1.00
R0006:Slc7a9 UTSW 7 35470100 unclassified probably benign
R1703:Slc7a9 UTSW 7 35454575 missense probably benign
R1886:Slc7a9 UTSW 7 35453402 missense possibly damaging 0.94
R1886:Slc7a9 UTSW 7 35453403 missense probably damaging 0.96
R1907:Slc7a9 UTSW 7 35449854 missense probably benign 0.00
R2027:Slc7a9 UTSW 7 35454137 missense probably damaging 0.97
R2133:Slc7a9 UTSW 7 35453493 missense probably damaging 0.99
R2937:Slc7a9 UTSW 7 35463742 nonsense probably null
R3684:Slc7a9 UTSW 7 35453501 missense probably benign 0.02
R4506:Slc7a9 UTSW 7 35453420 missense probably damaging 1.00
R4731:Slc7a9 UTSW 7 35453563 nonsense probably null
R4732:Slc7a9 UTSW 7 35453563 nonsense probably null
R4733:Slc7a9 UTSW 7 35453563 nonsense probably null
R5007:Slc7a9 UTSW 7 35454129 missense probably benign 0.09
R6405:Slc7a9 UTSW 7 35454639 missense probably damaging 1.00
R6701:Slc7a9 UTSW 7 35459849 missense probably damaging 1.00
R6932:Slc7a9 UTSW 7 35452511 missense probably benign 0.16
R7760:Slc7a9 UTSW 7 35457075 missense possibly damaging 0.88
R8121:Slc7a9 UTSW 7 35454117 missense probably damaging 1.00
R8177:Slc7a9 UTSW 7 35456133 missense probably benign
R8185:Slc7a9 UTSW 7 35452417 missense probably damaging 1.00
R8416:Slc7a9 UTSW 7 35453433 missense probably benign 0.41
X0022:Slc7a9 UTSW 7 35452502 missense possibly damaging 0.91
Z1177:Slc7a9 UTSW 7 35453570 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCGTTCTTTGGTAGAAGTAACTTAC -3'
(R):5'- CTTAACTCACAGAATTAGGGATAGC -3'

Sequencing Primer
(F):5'- ACTTCTGAAGCTCCCATGCAGTG -3'
(R):5'- GTTTTCATTAAGAAAAACACCAG -3'
Posted On2017-10-10