Mutagenetix > Incidental Mutation

Incidental Mutation 'R6175:Muc2'

487694

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

044317-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6175 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 141696632 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 627 (C627F)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179227
AA Change: C59F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515
AA Change: C59F

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: C627F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: C627F

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,066,614	K623E	probably damaging	Het
A530064D06Rik	T	A	17: 48,152,848	S227C	possibly damaging	Het
Adam30	A	T	3: 98,162,950	I700F	probably damaging	Het
Adam5	A	T	8: 24,786,151	M500K	probably benign	Het
Adgb	A	T	10: 10,398,943	S755T	possibly damaging	Het
Adgrv1	C	T	13: 81,386,005	G5819D	probably damaging	Het
Ank3	T	A	10: 69,927,727	Y17N	probably damaging	Het
Ano2	A	T	6: 125,992,955	M745L	probably benign	Het
Arap2	A	G	5: 62,714,731		probably null	Het
Atg2a	A	T	19: 6,241,729		probably benign	Het
AU021092	G	T	16: 5,220,448		probably null	Het
Bbs1	A	T	19: 4,890,721	L578Q	probably damaging	Het
Brd9	A	T	13: 73,960,314	E589D	probably damaging	Het
Calr4	A	G	4: 109,244,245	D108G	probably benign	Het
Ccdc82	A	G	9: 13,272,479	D429G	probably damaging	Het
Cdh22	G	T	2: 165,146,630	N268K	probably damaging	Het
Ceacam12	G	A	7: 18,067,387	G97D	probably damaging	Het
Clcn1	A	G	6: 42,314,162	D990G	probably damaging	Het
Cyp2c40	T	C	19: 39,812,560	T84A	probably benign	Het
Dnah7a	G	A	1: 53,433,022	P3529S	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Efna3	GAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGC	3: 89,322,798		probably benign	Het
Ehd2	G	A	7: 15,963,464	Q4*	probably null	Het
Eml5	A	G	12: 98,794,456	V1726A	possibly damaging	Het
Esam	A	G	9: 37,528,248	T10A	probably benign	Het
Fam19a1	A	G	6: 96,115,740	H35R	probably benign	Het
Fbxl6	A	G	15: 76,538,433	L95P	probably benign	Het
Fbxw18	T	A	9: 109,676,879	L441F	probably damaging	Het
Fbxw4	A	G	19: 45,636,327	S73P	probably benign	Het
Fndc1	T	A	17: 7,772,647	H739L	unknown	Het
Foxp1	G	A	6: 98,966,076	T237I	probably damaging	Het
Gm13212	A	T	4: 145,624,241		probably benign	Het
Gm4969	C	A	7: 19,100,889		probably benign	Het
Greb1	A	T	12: 16,674,770	I1801N	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hoxa13	G	T	6: 52,259,928	N281K	probably damaging	Het
Hspg2	A	G	4: 137,569,518	T4328A	probably damaging	Het
Htr2a	C	G	14: 74,645,034	Y153*	probably null	Het
Iglv1	C	A	16: 19,085,094	A92S	probably damaging	Het
Itih1	A	G	14: 30,931,195	S759P	probably damaging	Het
Kctd1	G	T	18: 14,969,631	S831*	probably null	Het
Kif20a	T	A	18: 34,628,146	S265T	probably damaging	Het
Kif22	T	A	7: 127,031,056	E436V	possibly damaging	Het
Kif27	A	G	13: 58,311,237	W927R	probably damaging	Het
Lcorl	G	A	5: 45,776,490	P66L	probably damaging	Het
Lct	A	G	1: 128,327,714	L197P	probably damaging	Het
Lefty1	T	C	1: 180,935,149	S14P	unknown	Het
Lnp1	A	G	16: 56,917,492	S78P	possibly damaging	Het
Map3k19	A	T	1: 127,822,832	H927Q	probably benign	Het
Mta3	A	G	17: 83,791,793	T430A	probably benign	Het
Myh13	A	G	11: 67,354,762	D1076G	probably benign	Het
Nck2	T	A	1: 43,533,569	M1K	probably null	Het
Nipal1	A	G	5: 72,663,555	N131S	probably damaging	Het
Nlrp9c	T	C	7: 26,378,001		probably null	Het
Nr2f2	A	G	7: 70,358,198	S179P	probably damaging	Het
Olfr1013	A	T	2: 85,770,308	N169I	probably benign	Het
Olfr345	A	G	2: 36,640,051	D4G	probably benign	Het
Olfr50	A	T	2: 36,793,968	H244L	probably damaging	Het
Oxt	G	T	2: 130,576,243		probably benign	Het
Pank2	T	A	2: 131,280,261	Y235*	probably null	Het
Pear1	A	G	3: 87,752,133	L798P	possibly damaging	Het
Pex14	T	C	4: 148,961,699	H258R	probably benign	Het
Pmpcb	A	G	5: 21,757,033	I487V	probably benign	Het
Ppie	T	C	4: 123,137,569	E44G	probably benign	Het
Ppp1r9a	A	T	6: 4,905,639	R65*	probably null	Het
Ralgapb	T	C	2: 158,446,155	S371P	probably damaging	Het
Ros1	T	C	10: 52,101,785	H1455R	probably benign	Het
Sacs	C	A	14: 61,212,826	T4107K	possibly damaging	Het
Sec24a	G	A	11: 51,731,891	T386M	probably damaging	Het
Slc10a4	A	T	5: 73,012,250	Y207F	possibly damaging	Het
Slc30a10	T	C	1: 185,455,311	L83P	probably damaging	Het
Slc38a9	T	A	13: 112,703,559	L324*	probably null	Het
Slc7a9	A	T	7: 35,465,852	Q474L	probably damaging	Het
Smc5	C	A	19: 23,214,170	V875L	possibly damaging	Het
Snap91	T	C	9: 86,825,000	R246G	probably damaging	Het
Sned1	A	G	1: 93,275,474		probably null	Het
Spink14	G	A	18: 44,031,871	G85E	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
St13	A	G	15: 81,399,305		probably null	Het
Stk10	A	G	11: 32,603,761	M593V	possibly damaging	Het
Tex21	C	A	12: 76,198,933	A530S	probably benign	Het
Tln2	T	A	9: 67,224,081	K1394N	probably damaging	Het
Trhr2	C	A	8: 122,357,379	R294L	probably damaging	Het
Unc79	A	T	12: 103,183,449	I2408F	probably damaging	Het
Wdr24	T	C	17: 25,826,578	L429P	probably damaging	Het
Wwp2	T	A	8: 107,483,407	I139N	possibly damaging	Het
Zfp111	G	A	7: 24,198,129	R686C	unknown	Het
Zyg11a	A	G	4: 108,189,681	V532A	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- AGCCACCAAAGTGTGCTCTG -3'
(R):5'- AGGGAAATCTGTTGCTTCCG -3'

Sequencing Primer
(F):5'- ACCCGGCTGAGCTGTGAG -3'
(R):5'- GGAAATCTGTTGCTTCCGCCATAAG -3'

Posted On

2017-10-10