Incidental Mutation 'R6175:Muc2'
ID 487694
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 044317-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R6175 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 141282875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 627 (C627F)
Ref Sequence ENSEMBL: ENSMUSP00000141040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000167366
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179227
AA Change: C59F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515
AA Change: C59F

DomainStartEndE-ValueType
C8 11 85 1.61e-32 SMART
Blast:VWD 102 128 5e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185406
AA Change: C627F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: C627F

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.5e-40 SMART
C8 216 290 3.9e-15 SMART
Pfam:TIL 293 349 5.4e-10 PFAM
VWC 351 411 7e-4 SMART
VWD 378 542 8.8e-44 SMART
C8 579 653 1.2e-36 SMART
SCOP:d1coua_ 654 728 4e-8 SMART
VWC_def 820 865 1.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185823
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,902,448 (GRCm39) K623E probably damaging Het
A530064D06Rik T A 17: 48,460,016 (GRCm39) S227C possibly damaging Het
Adam30 A T 3: 98,070,266 (GRCm39) I700F probably damaging Het
Adam5 A T 8: 25,276,167 (GRCm39) M500K probably benign Het
Adgb A T 10: 10,274,687 (GRCm39) S755T possibly damaging Het
Adgrv1 C T 13: 81,534,124 (GRCm39) G5819D probably damaging Het
Ank3 T A 10: 69,763,557 (GRCm39) Y17N probably damaging Het
Ano2 A T 6: 125,969,918 (GRCm39) M745L probably benign Het
Arap2 A G 5: 62,872,074 (GRCm39) probably null Het
Atg2a A T 19: 6,291,759 (GRCm39) probably benign Het
AU021092 G T 16: 5,038,312 (GRCm39) probably null Het
Bbs1 A T 19: 4,940,749 (GRCm39) L578Q probably damaging Het
Brd9 A T 13: 74,108,433 (GRCm39) E589D probably damaging Het
Calr4 A G 4: 109,101,442 (GRCm39) D108G probably benign Het
Ccdc82 A G 9: 13,272,798 (GRCm39) D429G probably damaging Het
Cdh22 G T 2: 164,988,550 (GRCm39) N268K probably damaging Het
Ceacam12 G A 7: 17,801,312 (GRCm39) G97D probably damaging Het
Clcn1 A G 6: 42,291,096 (GRCm39) D990G probably damaging Het
Cyp2c40 T C 19: 39,801,004 (GRCm39) T84A probably benign Het
Dnah7a G A 1: 53,472,181 (GRCm39) P3529S probably damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,230,105 (GRCm39) probably benign Het
Ehd2 G A 7: 15,697,389 (GRCm39) Q4* probably null Het
Eml5 A G 12: 98,760,715 (GRCm39) V1726A possibly damaging Het
Esam A G 9: 37,439,544 (GRCm39) T10A probably benign Het
Fbxl6 A G 15: 76,422,633 (GRCm39) L95P probably benign Het
Fbxw18 T A 9: 109,505,947 (GRCm39) L441F probably damaging Het
Fbxw4 A G 19: 45,624,766 (GRCm39) S73P probably benign Het
Fndc1 T A 17: 7,991,479 (GRCm39) H739L unknown Het
Foxp1 G A 6: 98,943,037 (GRCm39) T237I probably damaging Het
Greb1 A T 12: 16,724,771 (GRCm39) I1801N probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hoxa13 G T 6: 52,236,908 (GRCm39) N281K probably damaging Het
Hspg2 A G 4: 137,296,829 (GRCm39) T4328A probably damaging Het
Htr2a C G 14: 74,882,474 (GRCm39) Y153* probably null Het
Iglv1 C A 16: 18,903,844 (GRCm39) A92S probably damaging Het
Itih1 A G 14: 30,653,152 (GRCm39) S759P probably damaging Het
Kctd1 G T 18: 15,102,688 (GRCm39) S831* probably null Het
Kif20a T A 18: 34,761,199 (GRCm39) S265T probably damaging Het
Kif22 T A 7: 126,630,228 (GRCm39) E436V possibly damaging Het
Kif27 A G 13: 58,459,051 (GRCm39) W927R probably damaging Het
Lcorl G A 5: 45,933,832 (GRCm39) P66L probably damaging Het
Lct A G 1: 128,255,451 (GRCm39) L197P probably damaging Het
Lefty1 T C 1: 180,762,714 (GRCm39) S14P unknown Het
Lnp1 A G 16: 56,737,855 (GRCm39) S78P possibly damaging Het
Map3k19 A T 1: 127,750,569 (GRCm39) H927Q probably benign Het
Meiosin C A 7: 18,834,814 (GRCm39) probably benign Het
Mta3 A G 17: 84,099,222 (GRCm39) T430A probably benign Het
Myh13 A G 11: 67,245,588 (GRCm39) D1076G probably benign Het
Nck2 T A 1: 43,572,729 (GRCm39) M1K probably null Het
Nipal1 A G 5: 72,820,898 (GRCm39) N131S probably damaging Het
Nlrp9c T C 7: 26,077,426 (GRCm39) probably null Het
Nr2f2 A G 7: 70,007,946 (GRCm39) S179P probably damaging Het
Or1j16 A G 2: 36,530,063 (GRCm39) D4G probably benign Het
Or1j21 A T 2: 36,683,980 (GRCm39) H244L probably damaging Het
Or9g19 A T 2: 85,600,652 (GRCm39) N169I probably benign Het
Oxt G T 2: 130,418,163 (GRCm39) probably benign Het
Pank2 T A 2: 131,122,181 (GRCm39) Y235* probably null Het
Pear1 A G 3: 87,659,440 (GRCm39) L798P possibly damaging Het
Pex14 T C 4: 149,046,156 (GRCm39) H258R probably benign Het
Pmpcb A G 5: 21,962,031 (GRCm39) I487V probably benign Het
Ppie T C 4: 123,031,362 (GRCm39) E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 (GRCm39) R65* probably null Het
Ralgapb T C 2: 158,288,075 (GRCm39) S371P probably damaging Het
Ros1 T C 10: 51,977,881 (GRCm39) H1455R probably benign Het
Sacs C A 14: 61,450,275 (GRCm39) T4107K possibly damaging Het
Sec24a G A 11: 51,622,718 (GRCm39) T386M probably damaging Het
Slc10a4 A T 5: 73,169,593 (GRCm39) Y207F possibly damaging Het
Slc30a10 T C 1: 185,187,508 (GRCm39) L83P probably damaging Het
Slc38a9 T A 13: 112,840,093 (GRCm39) L324* probably null Het
Slc7a9 A T 7: 35,165,277 (GRCm39) Q474L probably damaging Het
Smc5 C A 19: 23,191,534 (GRCm39) V875L possibly damaging Het
Snap91 T C 9: 86,707,053 (GRCm39) R246G probably damaging Het
Sned1 A G 1: 93,203,196 (GRCm39) probably null Het
Spink14 G A 18: 44,164,938 (GRCm39) G85E probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
St13 A G 15: 81,283,506 (GRCm39) probably null Het
Stk10 A G 11: 32,553,761 (GRCm39) M593V possibly damaging Het
Tafa1 A G 6: 96,092,721 (GRCm39) H35R probably benign Het
Tex21 C A 12: 76,245,707 (GRCm39) A530S probably benign Het
Tln2 T A 9: 67,131,363 (GRCm39) K1394N probably damaging Het
Trhr2 C A 8: 123,084,118 (GRCm39) R294L probably damaging Het
Unc79 A T 12: 103,149,708 (GRCm39) I2408F probably damaging Het
Wdr24 T C 17: 26,045,552 (GRCm39) L429P probably damaging Het
Wwp2 T A 8: 108,210,039 (GRCm39) I139N possibly damaging Het
Zfp111 G A 7: 23,897,554 (GRCm39) R686C unknown Het
Zfp268 A T 4: 145,350,811 (GRCm39) probably benign Het
Zyg11a A G 4: 108,046,878 (GRCm39) V532A probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGCCACCAAAGTGTGCTCTG -3'
(R):5'- AGGGAAATCTGTTGCTTCCG -3'

Sequencing Primer
(F):5'- ACCCGGCTGAGCTGTGAG -3'
(R):5'- GGAAATCTGTTGCTTCCGCCATAAG -3'
Posted On 2017-10-10