Incidental Mutation 'R0524:Clca3b'
List |< first << previous [record 6 of 51] next >> last >|
ID48770
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144825321 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 756 (H756L)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: H756L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: H756L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACAGAGACTCTGAAAGTGTTTGC -3'
(R):5'- TTTCAATATCTGCACTGAGTACCGGC -3'

Sequencing Primer
(F):5'- CCCTTTGTTGGGACAAAAGGATAC -3'
(R):5'- CAAGAACAGACATGACAACATAAAAG -3'
Posted On2013-06-12