Incidental Mutation 'R6175:Adgb'
ID487703
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 044317-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6175 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10398943 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 755 (S755T)
Ref Sequence ENSEMBL: ENSMUSP00000134378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000045328
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132573
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172530
AA Change: S755T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: S755T

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179956
AA Change: S757T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: S757T

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208717
AA Change: S731T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1929 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Brd9 A T 13: 73,960,314 E589D probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Cdh22 G T 2: 165,146,630 N268K probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah7a G A 1: 53,433,022 P3529S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nlrp9c T C 7: 26,378,001 probably null Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Slc7a9 A T 7: 35,465,852 Q474L probably damaging Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
St13 A G 15: 81,399,305 probably null Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Tln2 T A 9: 67,224,081 K1394N probably damaging Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
R7128:Adgb UTSW 10 10472241 missense probably benign 0.26
R7326:Adgb UTSW 10 10400574 missense possibly damaging 0.80
R7386:Adgb UTSW 10 10377949 missense possibly damaging 0.52
R7431:Adgb UTSW 10 10391955 intron probably null
R7569:Adgb UTSW 10 10431252 missense probably benign
R7579:Adgb UTSW 10 10410818 nonsense probably null
R7582:Adgb UTSW 10 10390821 missense probably damaging 1.00
R7615:Adgb UTSW 10 10436010 missense probably damaging 0.96
R7692:Adgb UTSW 10 10411712 critical splice donor site probably null
R7774:Adgb UTSW 10 10339660 nonsense probably null
R7808:Adgb UTSW 10 10378659 splice site probably null
R8158:Adgb UTSW 10 10378734 missense probably benign 0.22
R8386:Adgb UTSW 10 10350304 missense probably damaging 1.00
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10378742 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTTCTCAGAGATCACACCTCAC -3'
(R):5'- GCAAATCTAGGTAGTTATCCCTTCTG -3'

Sequencing Primer
(F):5'- GATCACACCTCACCATTTATTAGAGG -3'
(R):5'- TGATCAGGCAACTAGCAG -3'
Posted On2017-10-10