Incidental Mutation 'R0524:Clca4a'
ID48771
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Namechloride channel accessory 4A
SynonymsClca6, 9130020L07Rik
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144952480-144975045 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144969393 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 159 (W159R)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
Predicted Effect probably damaging
Transcript: ENSMUST00000029923
AA Change: W159R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: W159R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198898
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1137:Clca4a UTSW 3 144970685 missense probably damaging 1.00
R1568:Clca4a UTSW 3 144952929 missense probably benign 0.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3078:Clca4a UTSW 3 144968253 missense probably damaging 0.99
R3080:Clca4a UTSW 3 144963790 missense probably damaging 1.00
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
R7516:Clca4a UTSW 3 144966248 missense probably damaging 1.00
R7642:Clca4a UTSW 3 144953751 missense probably benign 0.11
R7731:Clca4a UTSW 3 144952785 missense probably benign 0.02
R7787:Clca4a UTSW 3 144953833 missense probably benign
R7820:Clca4a UTSW 3 144960671 missense probably damaging 1.00
R7895:Clca4a UTSW 3 144968405 missense probably benign 0.19
R7978:Clca4a UTSW 3 144968405 missense probably benign 0.19
R8240:Clca4a UTSW 3 144970727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTGTCTTCAAGGAGAATGCCCTAA -3'
(R):5'- CCTTTGACACGCCAAGAACTGAAAATC -3'

Sequencing Primer
(F):5'- GCCTTCAAGCAAAATATGGATGC -3'
(R):5'- tctttctcttcccctctcttttc -3'
Posted On2013-06-12