Incidental Mutation 'R0524:Clca4a'
ID 48771
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Name chloride channel accessory 4A
Synonyms Clca6, 9130020L07Rik
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144658247-144680806 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144675154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 159 (W159R)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029923
AA Change: W159R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: W159R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198898
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144,660,700 (GRCm39) missense probably damaging 0.99
IGL01139:Clca4a APN 3 144,672,030 (GRCm39) missense probably damaging 0.99
IGL01371:Clca4a APN 3 144,666,433 (GRCm39) missense probably damaging 1.00
IGL01609:Clca4a APN 3 144,659,541 (GRCm39) missense probably damaging 1.00
IGL01998:Clca4a APN 3 144,663,887 (GRCm39) missense probably damaging 0.98
IGL02172:Clca4a APN 3 144,676,155 (GRCm39) nonsense probably null
IGL02217:Clca4a APN 3 144,667,757 (GRCm39) missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144,660,832 (GRCm39) missense probably damaging 1.00
IGL02975:Clca4a APN 3 144,669,530 (GRCm39) missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144,663,079 (GRCm39) missense probably benign 0.07
IGL03049:Clca4a APN 3 144,676,516 (GRCm39) splice site probably benign
IGL03058:Clca4a APN 3 144,667,595 (GRCm39) splice site probably benign
IGL03259:Clca4a APN 3 144,663,841 (GRCm39) missense probably damaging 1.00
IGL03263:Clca4a APN 3 144,672,192 (GRCm39) missense probably damaging 1.00
IGL03334:Clca4a APN 3 144,659,627 (GRCm39) missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144,674,072 (GRCm39) missense probably damaging 1.00
R0201:Clca4a UTSW 3 144,666,478 (GRCm39) missense probably benign 0.00
R0316:Clca4a UTSW 3 144,659,525 (GRCm39) missense probably damaging 1.00
R0680:Clca4a UTSW 3 144,675,128 (GRCm39) missense probably damaging 1.00
R0688:Clca4a UTSW 3 144,667,735 (GRCm39) missense probably damaging 1.00
R1137:Clca4a UTSW 3 144,676,446 (GRCm39) missense probably damaging 1.00
R1568:Clca4a UTSW 3 144,658,690 (GRCm39) missense probably benign 0.00
R1719:Clca4a UTSW 3 144,669,516 (GRCm39) missense probably damaging 1.00
R2055:Clca4a UTSW 3 144,676,489 (GRCm39) missense probably damaging 1.00
R3078:Clca4a UTSW 3 144,674,014 (GRCm39) missense probably damaging 0.99
R3080:Clca4a UTSW 3 144,669,551 (GRCm39) missense probably damaging 1.00
R3789:Clca4a UTSW 3 144,680,717 (GRCm39) missense probably damaging 1.00
R3881:Clca4a UTSW 3 144,663,079 (GRCm39) missense probably benign 0.07
R4133:Clca4a UTSW 3 144,675,113 (GRCm39) missense probably benign 0.07
R4402:Clca4a UTSW 3 144,658,609 (GRCm39) missense probably benign 0.08
R4455:Clca4a UTSW 3 144,663,020 (GRCm39) missense probably damaging 1.00
R4577:Clca4a UTSW 3 144,660,730 (GRCm39) missense probably damaging 0.97
R4683:Clca4a UTSW 3 144,660,701 (GRCm39) missense probably damaging 1.00
R5135:Clca4a UTSW 3 144,660,707 (GRCm39) missense probably damaging 1.00
R5267:Clca4a UTSW 3 144,659,573 (GRCm39) missense probably damaging 1.00
R5345:Clca4a UTSW 3 144,676,222 (GRCm39) missense probably damaging 1.00
R6311:Clca4a UTSW 3 144,672,174 (GRCm39) missense probably damaging 0.99
R6492:Clca4a UTSW 3 144,663,059 (GRCm39) missense probably benign 0.00
R6493:Clca4a UTSW 3 144,663,059 (GRCm39) missense probably benign 0.00
R6494:Clca4a UTSW 3 144,663,059 (GRCm39) missense probably benign 0.00
R6861:Clca4a UTSW 3 144,676,416 (GRCm39) missense probably benign
R7102:Clca4a UTSW 3 144,667,670 (GRCm39) missense probably benign 0.01
R7133:Clca4a UTSW 3 144,667,651 (GRCm39) nonsense probably null
R7171:Clca4a UTSW 3 144,663,934 (GRCm39) missense probably benign
R7516:Clca4a UTSW 3 144,672,009 (GRCm39) missense probably damaging 1.00
R7642:Clca4a UTSW 3 144,659,512 (GRCm39) missense probably benign 0.11
R7731:Clca4a UTSW 3 144,658,546 (GRCm39) missense probably benign 0.02
R7787:Clca4a UTSW 3 144,659,594 (GRCm39) missense probably benign
R7820:Clca4a UTSW 3 144,666,432 (GRCm39) missense probably damaging 1.00
R7895:Clca4a UTSW 3 144,674,166 (GRCm39) missense probably benign 0.19
R7991:Clca4a UTSW 3 144,658,500 (GRCm39) missense possibly damaging 0.75
R8240:Clca4a UTSW 3 144,676,488 (GRCm39) missense probably damaging 1.00
R9308:Clca4a UTSW 3 144,676,183 (GRCm39) missense probably damaging 1.00
R9373:Clca4a UTSW 3 144,672,133 (GRCm39) missense possibly damaging 0.66
R9488:Clca4a UTSW 3 144,659,532 (GRCm39) missense probably damaging 1.00
R9772:Clca4a UTSW 3 144,676,422 (GRCm39) missense probably damaging 1.00
R9781:Clca4a UTSW 3 144,667,713 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCATTGTCTTCAAGGAGAATGCCCTAA -3'
(R):5'- CCTTTGACACGCCAAGAACTGAAAATC -3'

Sequencing Primer
(F):5'- GCCTTCAAGCAAAATATGGATGC -3'
(R):5'- tctttctcttcccctctcttttc -3'
Posted On 2013-06-12