Mutagenetix > Incidental Mutation

Incidental Mutation 'R6175:Eml5'

487712

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

044317-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R6175 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98794456 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1726 (V1726A)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably benign
Transcript: ENSMUST00000065716
AA Change: V1679A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V1679A

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220848

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221902

Predicted Effect

probably benign
Transcript: ENSMUST00000222097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222717

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223282
AA Change: V1726A

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

97% (85/88)

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,066,614	K623E	probably damaging	Het
A530064D06Rik	T	A	17: 48,152,848	S227C	possibly damaging	Het
Adam30	A	T	3: 98,162,950	I700F	probably damaging	Het
Adam5	A	T	8: 24,786,151	M500K	probably benign	Het
Adgb	A	T	10: 10,398,943	S755T	possibly damaging	Het
Adgrv1	C	T	13: 81,386,005	G5819D	probably damaging	Het
Ank3	T	A	10: 69,927,727	Y17N	probably damaging	Het
Ano2	A	T	6: 125,992,955	M745L	probably benign	Het
Arap2	A	G	5: 62,714,731		probably null	Het
Atg2a	A	T	19: 6,241,729		probably benign	Het
AU021092	G	T	16: 5,220,448		probably null	Het
Bbs1	A	T	19: 4,890,721	L578Q	probably damaging	Het
Brd9	A	T	13: 73,960,314	E589D	probably damaging	Het
Calr4	A	G	4: 109,244,245	D108G	probably benign	Het
Ccdc82	A	G	9: 13,272,479	D429G	probably damaging	Het
Cdh22	G	T	2: 165,146,630	N268K	probably damaging	Het
Ceacam12	G	A	7: 18,067,387	G97D	probably damaging	Het
Clcn1	A	G	6: 42,314,162	D990G	probably damaging	Het
Cyp2c40	T	C	19: 39,812,560	T84A	probably benign	Het
Dnah7a	G	A	1: 53,433,022	P3529S	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Efna3	GAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGC	3: 89,322,798		probably benign	Het
Ehd2	G	A	7: 15,963,464	Q4*	probably null	Het
Esam	A	G	9: 37,528,248	T10A	probably benign	Het
Fam19a1	A	G	6: 96,115,740	H35R	probably benign	Het
Fbxl6	A	G	15: 76,538,433	L95P	probably benign	Het
Fbxw18	T	A	9: 109,676,879	L441F	probably damaging	Het
Fbxw4	A	G	19: 45,636,327	S73P	probably benign	Het
Fndc1	T	A	17: 7,772,647	H739L	unknown	Het
Foxp1	G	A	6: 98,966,076	T237I	probably damaging	Het
Gm13212	A	T	4: 145,624,241		probably benign	Het
Gm4969	C	A	7: 19,100,889		probably benign	Het
Greb1	A	T	12: 16,674,770	I1801N	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hoxa13	G	T	6: 52,259,928	N281K	probably damaging	Het
Hspg2	A	G	4: 137,569,518	T4328A	probably damaging	Het
Htr2a	C	G	14: 74,645,034	Y153*	probably null	Het
Iglv1	C	A	16: 19,085,094	A92S	probably damaging	Het
Itih1	A	G	14: 30,931,195	S759P	probably damaging	Het
Kctd1	G	T	18: 14,969,631	S831*	probably null	Het
Kif20a	T	A	18: 34,628,146	S265T	probably damaging	Het
Kif22	T	A	7: 127,031,056	E436V	possibly damaging	Het
Kif27	A	G	13: 58,311,237	W927R	probably damaging	Het
Lcorl	G	A	5: 45,776,490	P66L	probably damaging	Het
Lct	A	G	1: 128,327,714	L197P	probably damaging	Het
Lefty1	T	C	1: 180,935,149	S14P	unknown	Het
Lnp1	A	G	16: 56,917,492	S78P	possibly damaging	Het
Map3k19	A	T	1: 127,822,832	H927Q	probably benign	Het
Mta3	A	G	17: 83,791,793	T430A	probably benign	Het
Muc2	G	T	7: 141,696,632	C627F	probably damaging	Het
Myh13	A	G	11: 67,354,762	D1076G	probably benign	Het
Nck2	T	A	1: 43,533,569	M1K	probably null	Het
Nipal1	A	G	5: 72,663,555	N131S	probably damaging	Het
Nlrp9c	T	C	7: 26,378,001		probably null	Het
Nr2f2	A	G	7: 70,358,198	S179P	probably damaging	Het
Olfr1013	A	T	2: 85,770,308	N169I	probably benign	Het
Olfr345	A	G	2: 36,640,051	D4G	probably benign	Het
Olfr50	A	T	2: 36,793,968	H244L	probably damaging	Het
Oxt	G	T	2: 130,576,243		probably benign	Het
Pank2	T	A	2: 131,280,261	Y235*	probably null	Het
Pear1	A	G	3: 87,752,133	L798P	possibly damaging	Het
Pex14	T	C	4: 148,961,699	H258R	probably benign	Het
Pmpcb	A	G	5: 21,757,033	I487V	probably benign	Het
Ppie	T	C	4: 123,137,569	E44G	probably benign	Het
Ppp1r9a	A	T	6: 4,905,639	R65*	probably null	Het
Ralgapb	T	C	2: 158,446,155	S371P	probably damaging	Het
Ros1	T	C	10: 52,101,785	H1455R	probably benign	Het
Sacs	C	A	14: 61,212,826	T4107K	possibly damaging	Het
Sec24a	G	A	11: 51,731,891	T386M	probably damaging	Het
Slc10a4	A	T	5: 73,012,250	Y207F	possibly damaging	Het
Slc30a10	T	C	1: 185,455,311	L83P	probably damaging	Het
Slc38a9	T	A	13: 112,703,559	L324*	probably null	Het
Slc7a9	A	T	7: 35,465,852	Q474L	probably damaging	Het
Smc5	C	A	19: 23,214,170	V875L	possibly damaging	Het
Snap91	T	C	9: 86,825,000	R246G	probably damaging	Het
Sned1	A	G	1: 93,275,474		probably null	Het
Spink14	G	A	18: 44,031,871	G85E	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
St13	A	G	15: 81,399,305		probably null	Het
Stk10	A	G	11: 32,603,761	M593V	possibly damaging	Het
Tex21	C	A	12: 76,198,933	A530S	probably benign	Het
Tln2	T	A	9: 67,224,081	K1394N	probably damaging	Het
Trhr2	C	A	8: 122,357,379	R294L	probably damaging	Het
Unc79	A	T	12: 103,183,449	I2408F	probably damaging	Het
Wdr24	T	C	17: 25,826,578	L429P	probably damaging	Het
Wwp2	T	A	8: 107,483,407	I139N	possibly damaging	Het
Zfp111	G	A	7: 24,198,129	R686C	unknown	Het
Zyg11a	A	G	4: 108,189,681	V532A	probably benign	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGGGCTATAACACACTGTC -3'
(R):5'- TATTTCAGGGCAAGATACTAGTTGG -3'

Sequencing Primer
(F):5'- GAGCAGCGTGTCCCAAATTC -3'
(R):5'- TGGGACAAGGAATTCGGAAATAATTG -3'

Posted On

2017-10-10