Mutagenetix > Incidental Mutations

Incidental Mutation 'R6175:Kif27'

487714

Institutional Source

Beutler Lab

Gene Symbol

Kif27

Ensembl Gene

ENSMUSG00000060176

Gene Name

kinesin family member 27

Synonyms

4930517I18Rik

MMRRC Submission

044317-MU

Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R6175 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58287502-58359122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58311237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 927 (W927R)

Ref Sequence

ENSEMBL: ENSMUSP00000153598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]

AlphaFold

Q7M6Z4

Predicted Effect

probably damaging
Transcript: ENSMUST00000043605
AA Change: W927R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: W927R

Domain	Start	End	E-Value	Type
KISc	3	349	9.18e-160	SMART
low complexity region	369	385	N/A	INTRINSIC
coiled coil region	386	418	N/A	INTRINSIC
Blast:KISc	486	566	5e-29	BLAST
coiled coil region	710	790	N/A	INTRINSIC
coiled coil region	835	891	N/A	INTRINSIC
coiled coil region	916	972	N/A	INTRINSIC
low complexity region	993	1008	N/A	INTRINSIC
coiled coil region	1010	1078	N/A	INTRINSIC
coiled coil region	1186	1226	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183772

Predicted Effect

probably benign
Transcript: ENSMUST00000224694

Predicted Effect

probably damaging
Transcript: ENSMUST00000225388
AA Change: W927R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225680

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

97% (85/88)

MGI Phenotype

Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,066,614	K623E	probably damaging	Het
A530064D06Rik	T	A	17: 48,152,848	S227C	possibly damaging	Het
Adam30	A	T	3: 98,162,950	I700F	probably damaging	Het
Adam5	A	T	8: 24,786,151	M500K	probably benign	Het
Adgb	A	T	10: 10,398,943	S755T	possibly damaging	Het
Adgrv1	C	T	13: 81,386,005	G5819D	probably damaging	Het
Ank3	T	A	10: 69,927,727	Y17N	probably damaging	Het
Ano2	A	T	6: 125,992,955	M745L	probably benign	Het
Arap2	A	G	5: 62,714,731		probably null	Het
Atg2a	A	T	19: 6,241,729		probably benign	Het
AU021092	G	T	16: 5,220,448		probably null	Het
Bbs1	A	T	19: 4,890,721	L578Q	probably damaging	Het
Brd9	A	T	13: 73,960,314	E589D	probably damaging	Het
Calr4	A	G	4: 109,244,245	D108G	probably benign	Het
Ccdc82	A	G	9: 13,272,479	D429G	probably damaging	Het
Cdh22	G	T	2: 165,146,630	N268K	probably damaging	Het
Ceacam12	G	A	7: 18,067,387	G97D	probably damaging	Het
Clcn1	A	G	6: 42,314,162	D990G	probably damaging	Het
Cyp2c40	T	C	19: 39,812,560	T84A	probably benign	Het
Dnah7a	G	A	1: 53,433,022	P3529S	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Efna3	GAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGC	3: 89,322,798		probably benign	Het
Ehd2	G	A	7: 15,963,464	Q4*	probably null	Het
Eml5	A	G	12: 98,794,456	V1726A	possibly damaging	Het
Esam	A	G	9: 37,528,248	T10A	probably benign	Het
Fam19a1	A	G	6: 96,115,740	H35R	probably benign	Het
Fbxl6	A	G	15: 76,538,433	L95P	probably benign	Het
Fbxw18	T	A	9: 109,676,879	L441F	probably damaging	Het
Fbxw4	A	G	19: 45,636,327	S73P	probably benign	Het
Fndc1	T	A	17: 7,772,647	H739L	unknown	Het
Foxp1	G	A	6: 98,966,076	T237I	probably damaging	Het
Gm13212	A	T	4: 145,624,241		probably benign	Het
Gm4969	C	A	7: 19,100,889		probably benign	Het
Greb1	A	T	12: 16,674,770	I1801N	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hoxa13	G	T	6: 52,259,928	N281K	probably damaging	Het
Hspg2	A	G	4: 137,569,518	T4328A	probably damaging	Het
Htr2a	C	G	14: 74,645,034	Y153*	probably null	Het
Iglv1	C	A	16: 19,085,094	A92S	probably damaging	Het
Itih1	A	G	14: 30,931,195	S759P	probably damaging	Het
Kctd1	G	T	18: 14,969,631	S831*	probably null	Het
Kif20a	T	A	18: 34,628,146	S265T	probably damaging	Het
Kif22	T	A	7: 127,031,056	E436V	possibly damaging	Het
Lcorl	G	A	5: 45,776,490	P66L	probably damaging	Het
Lct	A	G	1: 128,327,714	L197P	probably damaging	Het
Lefty1	T	C	1: 180,935,149	S14P	unknown	Het
Lnp1	A	G	16: 56,917,492	S78P	possibly damaging	Het
Map3k19	A	T	1: 127,822,832	H927Q	probably benign	Het
Mta3	A	G	17: 83,791,793	T430A	probably benign	Het
Muc2	G	T	7: 141,696,632	C627F	probably damaging	Het
Myh13	A	G	11: 67,354,762	D1076G	probably benign	Het
Nck2	T	A	1: 43,533,569	M1K	probably null	Het
Nipal1	A	G	5: 72,663,555	N131S	probably damaging	Het
Nlrp9c	T	C	7: 26,378,001		probably null	Het
Nr2f2	A	G	7: 70,358,198	S179P	probably damaging	Het
Olfr1013	A	T	2: 85,770,308	N169I	probably benign	Het
Olfr345	A	G	2: 36,640,051	D4G	probably benign	Het
Olfr50	A	T	2: 36,793,968	H244L	probably damaging	Het
Oxt	G	T	2: 130,576,243		probably benign	Het
Pank2	T	A	2: 131,280,261	Y235*	probably null	Het
Pear1	A	G	3: 87,752,133	L798P	possibly damaging	Het
Pex14	T	C	4: 148,961,699	H258R	probably benign	Het
Pmpcb	A	G	5: 21,757,033	I487V	probably benign	Het
Ppie	T	C	4: 123,137,569	E44G	probably benign	Het
Ppp1r9a	A	T	6: 4,905,639	R65*	probably null	Het
Ralgapb	T	C	2: 158,446,155	S371P	probably damaging	Het
Ros1	T	C	10: 52,101,785	H1455R	probably benign	Het
Sacs	C	A	14: 61,212,826	T4107K	possibly damaging	Het
Sec24a	G	A	11: 51,731,891	T386M	probably damaging	Het
Slc10a4	A	T	5: 73,012,250	Y207F	possibly damaging	Het
Slc30a10	T	C	1: 185,455,311	L83P	probably damaging	Het
Slc38a9	T	A	13: 112,703,559	L324*	probably null	Het
Slc7a9	A	T	7: 35,465,852	Q474L	probably damaging	Het
Smc5	C	A	19: 23,214,170	V875L	possibly damaging	Het
Snap91	T	C	9: 86,825,000	R246G	probably damaging	Het
Sned1	A	G	1: 93,275,474		probably null	Het
Spink14	G	A	18: 44,031,871	G85E	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
St13	A	G	15: 81,399,305		probably null	Het
Stk10	A	G	11: 32,603,761	M593V	possibly damaging	Het
Tex21	C	A	12: 76,198,933	A530S	probably benign	Het
Tln2	T	A	9: 67,224,081	K1394N	probably damaging	Het
Trhr2	C	A	8: 122,357,379	R294L	probably damaging	Het
Unc79	A	T	12: 103,183,449	I2408F	probably damaging	Het
Wdr24	T	C	17: 25,826,578	L429P	probably damaging	Het
Wwp2	T	A	8: 107,483,407	I139N	possibly damaging	Het
Zfp111	G	A	7: 24,198,129	R686C	unknown	Het
Zyg11a	A	G	4: 108,189,681	V532A	probably benign	Het

Other mutations in Kif27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Kif27	APN	13	58337604	missense	probably benign
IGL00421:Kif27	APN	13	58343889	missense	probably damaging	1.00
IGL00903:Kif27	APN	13	58344672	missense	possibly damaging	0.69
IGL01024:Kif27	APN	13	58288201	missense	possibly damaging	0.71
IGL01070:Kif27	APN	13	58344093	missense	probably damaging	1.00
IGL01761:Kif27	APN	13	58337645	missense	probably benign
IGL02160:Kif27	APN	13	58325998	missense	probably damaging	1.00
IGL03162:Kif27	APN	13	58311207	missense	probably benign	0.03
P0016:Kif27	UTSW	13	58303452	nonsense	probably null
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0481:Kif27	UTSW	13	58311264	splice site	probably benign
R0960:Kif27	UTSW	13	58323967	missense	probably damaging	0.99
R1015:Kif27	UTSW	13	58320215	missense	probably damaging	1.00
R1205:Kif27	UTSW	13	58344205	missense	probably benign	0.00
R1478:Kif27	UTSW	13	58303545	missense	probably damaging	0.98
R1789:Kif27	UTSW	13	58344008	missense	probably damaging	1.00
R1959:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R1961:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R3508:Kif27	UTSW	13	58313212	missense	possibly damaging	0.88
R4168:Kif27	UTSW	13	58345748	missense	probably benign	0.01
R4247:Kif27	UTSW	13	58287917	missense	probably damaging	0.98
R4307:Kif27	UTSW	13	58344123	missense	probably benign	0.00
R4621:Kif27	UTSW	13	58331013	missense	probably benign	0.13
R4660:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4661:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4736:Kif27	UTSW	13	58328971	missense	probably benign	0.04
R4770:Kif27	UTSW	13	58344377	missense	probably damaging	1.00
R4853:Kif27	UTSW	13	58311258	missense	probably benign	0.06
R4963:Kif27	UTSW	13	58328994	missense	possibly damaging	0.85
R4998:Kif27	UTSW	13	58293143	missense	probably damaging	0.98
R5134:Kif27	UTSW	13	58291090	missense	possibly damaging	0.80
R5225:Kif27	UTSW	13	58293101	missense	possibly damaging	0.88
R5835:Kif27	UTSW	13	58313146	critical splice donor site	probably null
R5875:Kif27	UTSW	13	58311104	missense	probably benign	0.01
R5929:Kif27	UTSW	13	58343970	missense	probably benign	0.01
R6446:Kif27	UTSW	13	58345716	missense	probably damaging	1.00
R6628:Kif27	UTSW	13	58354797	missense	probably damaging	1.00
R7480:Kif27	UTSW	13	58288211	missense	probably benign	0.34
R8381:Kif27	UTSW	13	58291177	missense	probably benign	0.00
R8815:Kif27	UTSW	13	58329004	missense	probably damaging	0.97
R8993:Kif27	UTSW	13	58326098	missense	possibly damaging	0.93
R9181:Kif27	UTSW	13	58344729	missense	probably damaging	1.00
Z1088:Kif27	UTSW	13	58288033	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGGACTCAGCCATCTATCTAG -3'
(R):5'- AAGACAACACGCAGCATGTTAG -3'

Sequencing Primer
(F):5'- AGCTCCAGATTTTCCTGTTAGAGAG -3'
(R):5'- TGTTAGGCAGAATCACCAGTC -3'

Posted On

2017-10-10