Incidental Mutation 'R6175:Brd9'
ID487715
Institutional Source Beutler Lab
Gene Symbol Brd9
Ensembl Gene ENSMUSG00000057649
Gene Namebromodomain containing 9
Synonyms
MMRRC Submission 044317-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6175 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73937811-73960895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73960314 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 589 (E589D)
Ref Sequence ENSEMBL: ENSMUSP00000152390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091493] [ENSMUST00000099384] [ENSMUST00000222399] [ENSMUST00000222487] [ENSMUST00000222951]
Predicted Effect probably benign
Transcript: ENSMUST00000091493
SMART Domains Protein: ENSMUSP00000089075
Gene: ENSMUSG00000069189

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
Pfam:zf-DHHC 123 278 6.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099384
AA Change: E590D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096982
Gene: ENSMUSG00000057649
AA Change: E590D

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
coiled coil region 53 104 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
BROMO 134 242 1.52e-30 SMART
low complexity region 249 264 N/A INTRINSIC
Pfam:DUF3512 274 505 1.6e-82 PFAM
low complexity region 544 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222191
Predicted Effect probably damaging
Transcript: ENSMUST00000222399
AA Change: E589D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222479
Predicted Effect probably benign
Transcript: ENSMUST00000222487
Predicted Effect probably benign
Transcript: ENSMUST00000222951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223446
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgb A T 10: 10,398,943 S755T possibly damaging Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Cdh22 G T 2: 165,146,630 N268K probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah7a G A 1: 53,433,022 P3529S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nlrp9c T C 7: 26,378,001 probably null Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Slc7a9 A T 7: 35,465,852 Q474L probably damaging Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
St13 A G 15: 81,399,305 probably null Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Tln2 T A 9: 67,224,081 K1394N probably damaging Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Brd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Brd9 APN 13 73938547 missense probably damaging 0.98
IGL01461:Brd9 APN 13 73951598 nonsense probably null
IGL01928:Brd9 APN 13 73955511 missense probably benign 0.02
R0379:Brd9 UTSW 13 73942683 splice site probably benign
R0420:Brd9 UTSW 13 73955473 missense probably benign
R0788:Brd9 UTSW 13 73944867 splice site probably benign
R1539:Brd9 UTSW 13 73944743 missense probably damaging 0.99
R4095:Brd9 UTSW 13 73944799 missense probably benign 0.19
R4582:Brd9 UTSW 13 73947733 missense probably benign 0.00
R4648:Brd9 UTSW 13 73940776 missense probably benign 0.37
R4915:Brd9 UTSW 13 73938455 missense probably damaging 0.99
R6054:Brd9 UTSW 13 73940741 missense probably damaging 1.00
R6462:Brd9 UTSW 13 73940669 missense probably damaging 1.00
R6520:Brd9 UTSW 13 73942794 missense probably benign 0.00
R7217:Brd9 UTSW 13 73938944 missense probably damaging 1.00
R7360:Brd9 UTSW 13 73944823 missense probably benign 0.07
R7422:Brd9 UTSW 13 73954578 missense probably benign
R7556:Brd9 UTSW 13 73944767 missense possibly damaging 0.83
R7844:Brd9 UTSW 13 73938533 missense probably damaging 1.00
R7927:Brd9 UTSW 13 73938533 missense probably damaging 1.00
Z1176:Brd9 UTSW 13 73944751
Predicted Primers PCR Primer
(F):5'- AATGTACCTCTGTCTGGTGCC -3'
(R):5'- AGAGCTTATTGGACACCATTCGG -3'

Sequencing Primer
(F):5'- CCGGGGAGGACATTGGTCTTATTAG -3'
(R):5'- ACCATTCGGTGCTACTGGG -3'
Posted On2017-10-10