Mutagenetix > Incidental Mutations

Incidental Mutation 'R6175:Fbxl6'

487721

Institutional Source

Beutler Lab

Gene Symbol

Fbxl6

Ensembl Gene

ENSMUSG00000022559

Gene Name

F-box and leucine-rich repeat protein 6

Synonyms

MMRRC Submission

044317-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R6175 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76535721-76538746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76538433 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 95 (L95P)

Ref Sequence

ENSEMBL: ENSMUSP00000023219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]

Predicted Effect

probably benign
Transcript: ENSMUST00000023219
AA Change: L95P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: L95P

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
low complexity region	58	77	N/A	INTRINSIC
Pfam:F-box	104	154	3.1e-6	PFAM
Pfam:F-box-like	105	155	1.8e-13	PFAM
low complexity region	163	174	N/A	INTRINSIC
SCOP:d1yrga_	184	448	3e-9	SMART
Blast:LRR	211	236	2e-6	BLAST
Blast:LRR	347	373	6e-8	BLAST
Blast:LRR	375	405	7e-9	BLAST
Blast:LRR	432	456	7e-6	BLAST
Blast:LRR	464	488	1e-5	BLAST
Blast:LRR	489	520	7e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000023220

SMART Domains

Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	32	43	N/A	INTRINSIC
transmembrane domain	46	68	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
transmembrane domain	142	164	N/A	INTRINSIC
transmembrane domain	201	223	N/A	INTRINSIC
Pfam:DUF1011	278	376	3e-38	PFAM
transmembrane domain	409	431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229074

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230513

Predicted Effect

probably benign
Transcript: ENSMUST00000230604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230938

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230994

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

97% (85/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 79,066,614	K623E	probably damaging	Het
A530064D06Rik	T	A	17: 48,152,848	S227C	possibly damaging	Het
Adam30	A	T	3: 98,162,950	I700F	probably damaging	Het
Adam5	A	T	8: 24,786,151	M500K	probably benign	Het
Adgb	A	T	10: 10,398,943	S755T	possibly damaging	Het
Adgrv1	C	T	13: 81,386,005	G5819D	probably damaging	Het
Ank3	T	A	10: 69,927,727	Y17N	probably damaging	Het
Ano2	A	T	6: 125,992,955	M745L	probably benign	Het
Arap2	A	G	5: 62,714,731		probably null	Het
Atg2a	A	T	19: 6,241,729		probably benign	Het
AU021092	G	T	16: 5,220,448		probably null	Het
Bbs1	A	T	19: 4,890,721	L578Q	probably damaging	Het
Brd9	A	T	13: 73,960,314	E589D	probably damaging	Het
Calr4	A	G	4: 109,244,245	D108G	probably benign	Het
Ccdc82	A	G	9: 13,272,479	D429G	probably damaging	Het
Cdh22	G	T	2: 165,146,630	N268K	probably damaging	Het
Ceacam12	G	A	7: 18,067,387	G97D	probably damaging	Het
Clcn1	A	G	6: 42,314,162	D990G	probably damaging	Het
Cyp2c40	T	C	19: 39,812,560	T84A	probably benign	Het
Dnah7a	G	A	1: 53,433,022	P3529S	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Efna3	GAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGC	3: 89,322,798		probably benign	Het
Ehd2	G	A	7: 15,963,464	Q4*	probably null	Het
Eml5	A	G	12: 98,794,456	V1726A	possibly damaging	Het
Esam	A	G	9: 37,528,248	T10A	probably benign	Het
Fam19a1	A	G	6: 96,115,740	H35R	probably benign	Het
Fbxw18	T	A	9: 109,676,879	L441F	probably damaging	Het
Fbxw4	A	G	19: 45,636,327	S73P	probably benign	Het
Fndc1	T	A	17: 7,772,647	H739L	unknown	Het
Foxp1	G	A	6: 98,966,076	T237I	probably damaging	Het
Gm13212	A	T	4: 145,624,241		probably benign	Het
Gm4969	C	A	7: 19,100,889		probably benign	Het
Greb1	A	T	12: 16,674,770	I1801N	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hoxa13	G	T	6: 52,259,928	N281K	probably damaging	Het
Hspg2	A	G	4: 137,569,518	T4328A	probably damaging	Het
Htr2a	C	G	14: 74,645,034	Y153*	probably null	Het
Iglv1	C	A	16: 19,085,094	A92S	probably damaging	Het
Itih1	A	G	14: 30,931,195	S759P	probably damaging	Het
Kctd1	G	T	18: 14,969,631	S831*	probably null	Het
Kif20a	T	A	18: 34,628,146	S265T	probably damaging	Het
Kif22	T	A	7: 127,031,056	E436V	possibly damaging	Het
Kif27	A	G	13: 58,311,237	W927R	probably damaging	Het
Lcorl	G	A	5: 45,776,490	P66L	probably damaging	Het
Lct	A	G	1: 128,327,714	L197P	probably damaging	Het
Lefty1	T	C	1: 180,935,149	S14P	unknown	Het
Lnp1	A	G	16: 56,917,492	S78P	possibly damaging	Het
Map3k19	A	T	1: 127,822,832	H927Q	probably benign	Het
Mta3	A	G	17: 83,791,793	T430A	probably benign	Het
Muc2	G	T	7: 141,696,632	C627F	probably damaging	Het
Myh13	A	G	11: 67,354,762	D1076G	probably benign	Het
Nck2	T	A	1: 43,533,569	M1K	probably null	Het
Nipal1	A	G	5: 72,663,555	N131S	probably damaging	Het
Nlrp9c	T	C	7: 26,378,001		probably null	Het
Nr2f2	A	G	7: 70,358,198	S179P	probably damaging	Het
Olfr1013	A	T	2: 85,770,308	N169I	probably benign	Het
Olfr345	A	G	2: 36,640,051	D4G	probably benign	Het
Olfr50	A	T	2: 36,793,968	H244L	probably damaging	Het
Oxt	G	T	2: 130,576,243		probably benign	Het
Pank2	T	A	2: 131,280,261	Y235*	probably null	Het
Pear1	A	G	3: 87,752,133	L798P	possibly damaging	Het
Pex14	T	C	4: 148,961,699	H258R	probably benign	Het
Pmpcb	A	G	5: 21,757,033	I487V	probably benign	Het
Ppie	T	C	4: 123,137,569	E44G	probably benign	Het
Ppp1r9a	A	T	6: 4,905,639	R65*	probably null	Het
Ralgapb	T	C	2: 158,446,155	S371P	probably damaging	Het
Ros1	T	C	10: 52,101,785	H1455R	probably benign	Het
Sacs	C	A	14: 61,212,826	T4107K	possibly damaging	Het
Sec24a	G	A	11: 51,731,891	T386M	probably damaging	Het
Slc10a4	A	T	5: 73,012,250	Y207F	possibly damaging	Het
Slc30a10	T	C	1: 185,455,311	L83P	probably damaging	Het
Slc38a9	T	A	13: 112,703,559	L324*	probably null	Het
Slc7a9	A	T	7: 35,465,852	Q474L	probably damaging	Het
Smc5	C	A	19: 23,214,170	V875L	possibly damaging	Het
Snap91	T	C	9: 86,825,000	R246G	probably damaging	Het
Sned1	A	G	1: 93,275,474		probably null	Het
Spink14	G	A	18: 44,031,871	G85E	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
St13	A	G	15: 81,399,305		probably null	Het
Stk10	A	G	11: 32,603,761	M593V	possibly damaging	Het
Tex21	C	A	12: 76,198,933	A530S	probably benign	Het
Tln2	T	A	9: 67,224,081	K1394N	probably damaging	Het
Trhr2	C	A	8: 122,357,379	R294L	probably damaging	Het
Unc79	A	T	12: 103,183,449	I2408F	probably damaging	Het
Wdr24	T	C	17: 25,826,578	L429P	probably damaging	Het
Wwp2	T	A	8: 107,483,407	I139N	possibly damaging	Het
Zfp111	G	A	7: 24,198,129	R686C	unknown	Het
Zyg11a	A	G	4: 108,189,681	V532A	probably benign	Het

Other mutations in Fbxl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Fbxl6	APN	15	76535906	nonsense	probably null
IGL02205:Fbxl6	APN	15	76537341	missense	probably benign	0.05
R0244:Fbxl6	UTSW	15	76537191	missense	probably damaging	1.00
R0449:Fbxl6	UTSW	15	76535955	missense	probably damaging	1.00
R0608:Fbxl6	UTSW	15	76536753	missense	probably benign	0.04
R0904:Fbxl6	UTSW	15	76537083	splice site	probably null
R1477:Fbxl6	UTSW	15	76537734	missense	probably benign
R1784:Fbxl6	UTSW	15	76538058	missense	probably damaging	1.00
R2109:Fbxl6	UTSW	15	76536973	missense	probably damaging	0.99
R3937:Fbxl6	UTSW	15	76536624	nonsense	probably null
R4414:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4416:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4483:Fbxl6	UTSW	15	76537929	missense	probably damaging	1.00
R4835:Fbxl6	UTSW	15	76536804	missense	probably damaging	1.00
R6345:Fbxl6	UTSW	15	76535854	missense	probably damaging	1.00
R6750:Fbxl6	UTSW	15	76538412	missense	probably damaging	1.00
R6800:Fbxl6	UTSW	15	76538698	unclassified	probably benign
R7485:Fbxl6	UTSW	15	76537913	splice site	probably null
R7560:Fbxl6	UTSW	15	76538469	missense	probably benign	0.06
R7726:Fbxl6	UTSW	15	76535886	missense	probably damaging	1.00
R7811:Fbxl6	UTSW	15	76537285	splice site	probably null
X0058:Fbxl6	UTSW	15	76538476	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- ACTTGTGTTCGCCCGATGTG -3'
(R):5'- TCTAGGCGAGTTAGACGTCGAG -3'

Sequencing Primer
(F):5'- CCGATGTGATGCCTGCTCTG -3'
(R):5'- TCGAGTTCGAAGCTCCAAG -3'

Posted On

2017-10-10