Incidental Mutation 'R6175:Kctd1'
ID 487729
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Name potassium channel tetramerisation domain containing 1
Synonyms 4933402K10Rik
MMRRC Submission 044317-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6175 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 15101742-15284503 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 15102688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 831 (S831*)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000025992
AA Change: S235*
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225
AA Change: S235*

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168989
AA Change: S831*
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: S831*

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 78,902,448 (GRCm39) K623E probably damaging Het
A530064D06Rik T A 17: 48,460,016 (GRCm39) S227C possibly damaging Het
Adam30 A T 3: 98,070,266 (GRCm39) I700F probably damaging Het
Adam5 A T 8: 25,276,167 (GRCm39) M500K probably benign Het
Adgb A T 10: 10,274,687 (GRCm39) S755T possibly damaging Het
Adgrv1 C T 13: 81,534,124 (GRCm39) G5819D probably damaging Het
Ank3 T A 10: 69,763,557 (GRCm39) Y17N probably damaging Het
Ano2 A T 6: 125,969,918 (GRCm39) M745L probably benign Het
Arap2 A G 5: 62,872,074 (GRCm39) probably null Het
Atg2a A T 19: 6,291,759 (GRCm39) probably benign Het
AU021092 G T 16: 5,038,312 (GRCm39) probably null Het
Bbs1 A T 19: 4,940,749 (GRCm39) L578Q probably damaging Het
Brd9 A T 13: 74,108,433 (GRCm39) E589D probably damaging Het
Calr4 A G 4: 109,101,442 (GRCm39) D108G probably benign Het
Ccdc82 A G 9: 13,272,798 (GRCm39) D429G probably damaging Het
Cdh22 G T 2: 164,988,550 (GRCm39) N268K probably damaging Het
Ceacam12 G A 7: 17,801,312 (GRCm39) G97D probably damaging Het
Clcn1 A G 6: 42,291,096 (GRCm39) D990G probably damaging Het
Cyp2c40 T C 19: 39,801,004 (GRCm39) T84A probably benign Het
Dnah7a G A 1: 53,472,181 (GRCm39) P3529S probably damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,230,105 (GRCm39) probably benign Het
Ehd2 G A 7: 15,697,389 (GRCm39) Q4* probably null Het
Eml5 A G 12: 98,760,715 (GRCm39) V1726A possibly damaging Het
Esam A G 9: 37,439,544 (GRCm39) T10A probably benign Het
Fbxl6 A G 15: 76,422,633 (GRCm39) L95P probably benign Het
Fbxw18 T A 9: 109,505,947 (GRCm39) L441F probably damaging Het
Fbxw4 A G 19: 45,624,766 (GRCm39) S73P probably benign Het
Fndc1 T A 17: 7,991,479 (GRCm39) H739L unknown Het
Foxp1 G A 6: 98,943,037 (GRCm39) T237I probably damaging Het
Greb1 A T 12: 16,724,771 (GRCm39) I1801N probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hoxa13 G T 6: 52,236,908 (GRCm39) N281K probably damaging Het
Hspg2 A G 4: 137,296,829 (GRCm39) T4328A probably damaging Het
Htr2a C G 14: 74,882,474 (GRCm39) Y153* probably null Het
Iglv1 C A 16: 18,903,844 (GRCm39) A92S probably damaging Het
Itih1 A G 14: 30,653,152 (GRCm39) S759P probably damaging Het
Kif20a T A 18: 34,761,199 (GRCm39) S265T probably damaging Het
Kif22 T A 7: 126,630,228 (GRCm39) E436V possibly damaging Het
Kif27 A G 13: 58,459,051 (GRCm39) W927R probably damaging Het
Lcorl G A 5: 45,933,832 (GRCm39) P66L probably damaging Het
Lct A G 1: 128,255,451 (GRCm39) L197P probably damaging Het
Lefty1 T C 1: 180,762,714 (GRCm39) S14P unknown Het
Lnp1 A G 16: 56,737,855 (GRCm39) S78P possibly damaging Het
Map3k19 A T 1: 127,750,569 (GRCm39) H927Q probably benign Het
Meiosin C A 7: 18,834,814 (GRCm39) probably benign Het
Mta3 A G 17: 84,099,222 (GRCm39) T430A probably benign Het
Muc2 G T 7: 141,282,875 (GRCm39) C627F probably damaging Het
Myh13 A G 11: 67,245,588 (GRCm39) D1076G probably benign Het
Nck2 T A 1: 43,572,729 (GRCm39) M1K probably null Het
Nipal1 A G 5: 72,820,898 (GRCm39) N131S probably damaging Het
Nlrp9c T C 7: 26,077,426 (GRCm39) probably null Het
Nr2f2 A G 7: 70,007,946 (GRCm39) S179P probably damaging Het
Or1j16 A G 2: 36,530,063 (GRCm39) D4G probably benign Het
Or1j21 A T 2: 36,683,980 (GRCm39) H244L probably damaging Het
Or9g19 A T 2: 85,600,652 (GRCm39) N169I probably benign Het
Oxt G T 2: 130,418,163 (GRCm39) probably benign Het
Pank2 T A 2: 131,122,181 (GRCm39) Y235* probably null Het
Pear1 A G 3: 87,659,440 (GRCm39) L798P possibly damaging Het
Pex14 T C 4: 149,046,156 (GRCm39) H258R probably benign Het
Pmpcb A G 5: 21,962,031 (GRCm39) I487V probably benign Het
Ppie T C 4: 123,031,362 (GRCm39) E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 (GRCm39) R65* probably null Het
Ralgapb T C 2: 158,288,075 (GRCm39) S371P probably damaging Het
Ros1 T C 10: 51,977,881 (GRCm39) H1455R probably benign Het
Sacs C A 14: 61,450,275 (GRCm39) T4107K possibly damaging Het
Sec24a G A 11: 51,622,718 (GRCm39) T386M probably damaging Het
Slc10a4 A T 5: 73,169,593 (GRCm39) Y207F possibly damaging Het
Slc30a10 T C 1: 185,187,508 (GRCm39) L83P probably damaging Het
Slc38a9 T A 13: 112,840,093 (GRCm39) L324* probably null Het
Slc7a9 A T 7: 35,165,277 (GRCm39) Q474L probably damaging Het
Smc5 C A 19: 23,191,534 (GRCm39) V875L possibly damaging Het
Snap91 T C 9: 86,707,053 (GRCm39) R246G probably damaging Het
Sned1 A G 1: 93,203,196 (GRCm39) probably null Het
Spink14 G A 18: 44,164,938 (GRCm39) G85E probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
St13 A G 15: 81,283,506 (GRCm39) probably null Het
Stk10 A G 11: 32,553,761 (GRCm39) M593V possibly damaging Het
Tafa1 A G 6: 96,092,721 (GRCm39) H35R probably benign Het
Tex21 C A 12: 76,245,707 (GRCm39) A530S probably benign Het
Tln2 T A 9: 67,131,363 (GRCm39) K1394N probably damaging Het
Trhr2 C A 8: 123,084,118 (GRCm39) R294L probably damaging Het
Unc79 A T 12: 103,149,708 (GRCm39) I2408F probably damaging Het
Wdr24 T C 17: 26,045,552 (GRCm39) L429P probably damaging Het
Wwp2 T A 8: 108,210,039 (GRCm39) I139N possibly damaging Het
Zfp111 G A 7: 23,897,554 (GRCm39) R686C unknown Het
Zfp268 A T 4: 145,350,811 (GRCm39) probably benign Het
Zyg11a A G 4: 108,046,878 (GRCm39) V532A probably benign Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15,195,747 (GRCm39) missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01404:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15,195,694 (GRCm39) missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15,195,937 (GRCm39) missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 15,102,667 (GRCm39) missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 15,107,036 (GRCm39) critical splice donor site probably null
R0128:Kctd1 UTSW 18 15,107,237 (GRCm39) missense probably benign 0.00
R0598:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15,195,654 (GRCm39) missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15,195,517 (GRCm39) missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 15,102,617 (GRCm39) missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15,196,263 (GRCm39) intron probably benign
R1779:Kctd1 UTSW 18 15,194,839 (GRCm39) missense probably benign 0.01
R2083:Kctd1 UTSW 18 15,107,112 (GRCm39) missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15,195,268 (GRCm39) missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 15,107,143 (GRCm39) missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15,140,757 (GRCm39) missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15,196,284 (GRCm39) intron probably benign
R4884:Kctd1 UTSW 18 15,107,311 (GRCm39) missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15,195,580 (GRCm39) missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15,195,822 (GRCm39) missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15,195,322 (GRCm39) missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15,196,573 (GRCm39) intron probably benign
R5893:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R6767:Kctd1 UTSW 18 15,195,232 (GRCm39) missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 15,119,401 (GRCm39) missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 15,107,045 (GRCm39) missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15,195,700 (GRCm39) missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15,195,469 (GRCm39) missense possibly damaging 0.95
R7688:Kctd1 UTSW 18 15,107,255 (GRCm39) missense probably benign 0.03
R8085:Kctd1 UTSW 18 15,140,901 (GRCm39) missense possibly damaging 0.95
R8195:Kctd1 UTSW 18 15,196,300 (GRCm39) missense unknown
R8496:Kctd1 UTSW 18 15,107,228 (GRCm39) missense probably damaging 1.00
R8924:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R8978:Kctd1 UTSW 18 15,119,491 (GRCm39) missense
R9094:Kctd1 UTSW 18 15,195,369 (GRCm39) missense possibly damaging 0.71
R9255:Kctd1 UTSW 18 15,194,853 (GRCm39) missense probably benign 0.00
R9629:Kctd1 UTSW 18 15,196,611 (GRCm39) missense unknown
R9680:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
Z1176:Kctd1 UTSW 18 15,196,182 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCCCAGCTGCACACAAATG -3'
(R):5'- AAACTGGACCGTTACAGAATCTTC -3'

Sequencing Primer
(F):5'- AGCTGCACACAAATGTCCCTTTTC -3'
(R):5'- ACTCTACAACTGAGTGATGGCTCTG -3'
Posted On 2017-10-10