Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Wrap73'

48774

Institutional Source

Beutler Lab

Gene Symbol

Wrap73

Ensembl Gene

ENSMUSG00000029029

Gene Name

WD repeat containing, antisense to Trp73

Synonyms

DD57, Wdr8, 5330425N03Rik, 2610044M17Rik

MMRRC Submission

038717-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.793) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

154142372-154167420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 154145307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 45 (Y45C)

Ref Sequence

ENSEMBL: ENSMUSP00000030895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030895]

AlphaFold

Q9JM98

Predicted Effect

probably damaging
Transcript: ENSMUST00000030895
AA Change: Y45C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029
AA Change: Y45C

Domain	Start	End	E-Value	Type
Blast:WD40	38	77	4e-18	BLAST
Blast:WD40	81	120	6e-16	BLAST
Blast:WD40	125	163	9e-6	BLAST
WD40	167	208	2.28e2	SMART
WD40	215	251	1.58e-2	SMART
WD40	319	360	2.29e1	SMART
WD40	363	401	4.18e-2	SMART
Blast:WD40	402	443	2e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142665

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Studies of the related mouse protein suggest that the encoded protein may play a role in the process of ossification. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Wrap73

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Wrap73	APN	4	154152639	missense	probably damaging	0.99
IGL01562:Wrap73	APN	4	154145337	missense	possibly damaging	0.63
IGL01863:Wrap73	APN	4	154145333	missense	probably benign	0.02
IGL02342:Wrap73	APN	4	154148780	missense	probably benign	0.36
IGL03012:Wrap73	APN	4	154145234	splice site	probably benign
IGL03303:Wrap73	APN	4	154146543	missense	probably damaging	0.98
R0128:Wrap73	UTSW	4	154142500	missense	possibly damaging	0.81
R0455:Wrap73	UTSW	4	154148743	missense	possibly damaging	0.63
R0528:Wrap73	UTSW	4	154145319	missense	probably damaging	1.00
R0533:Wrap73	UTSW	4	154151649	missense	probably damaging	1.00
R0533:Wrap73	UTSW	4	154156154	missense	possibly damaging	0.91
R0633:Wrap73	UTSW	4	154142491	missense	probably damaging	0.98
R1118:Wrap73	UTSW	4	154152427	splice site	probably null
R1669:Wrap73	UTSW	4	154156131	missense	probably damaging	0.99
R1725:Wrap73	UTSW	4	154148752	missense	possibly damaging	0.73
R2070:Wrap73	UTSW	4	154148743	missense	possibly damaging	0.63
R4530:Wrap73	UTSW	4	154156707	unclassified	probably benign
R4669:Wrap73	UTSW	4	154151696	missense	probably benign	0.26
R4969:Wrap73	UTSW	4	154152681	missense	probably damaging	1.00
R5254:Wrap73	UTSW	4	154155346	missense	probably benign	0.00
R5334:Wrap73	UTSW	4	154145274	missense	probably damaging	0.97
R5428:Wrap73	UTSW	4	154145274	missense	probably damaging	0.97
R5431:Wrap73	UTSW	4	154145274	missense	probably damaging	0.97
R5728:Wrap73	UTSW	4	154154642	critical splice donor site	probably null
R7338:Wrap73	UTSW	4	154152586	missense	probably benign	0.26
R7426:Wrap73	UTSW	4	154156127	missense	probably damaging	1.00
R7480:Wrap73	UTSW	4	154152586	missense	probably benign	0.26
R7680:Wrap73	UTSW	4	154156622	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- GGTCCACATGAAGCTAAGTGTGTCG -3'
(R):5'- AACAGCGCCAGACCAGTTAGTTAC -3'

Sequencing Primer
(F):5'- CATGAAGCTAAGTGTGTCGAACAG -3'
(R):5'- CCAGACCAGTTAGTTACACATGAG -3'

Posted On

2013-06-12